A branch in the ToxR regulatory cascade of Vibrio cholerae revealed by characterization of toxT mutant strains

No abstract is available for this paper.

• Publication year

  1997

• Venue

  Molecular Microbiology

• Publication date

  1997-01-01

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1046/j.1365-2958.1997.2191585.xPMID 9044266
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Genetic analysis of the interaction between Vibrio cholerae transcription activator ToxR and toxT promoter DNA

  1996cited by this paper
• Cloning and characterization of the gene encoding the OmpU outer membrane protein of Vibrio cholerae

  1996cited by this paper
• Genetic footprint of the ToxR‐binding site in the promoter for cholera toxin

  1996cited by this paper
• Lysogenic Conversion by a Filamentous Phage Encoding Cholera Toxin

  1996influential reference
• Differential expression of the ToxR regulon in classical and E1 Tor biotypes of Vibrio cholerae is due to biotype-specific control over toxT expression.

  1996cited by this paper
• Organization of tcp, acf, and toxT genes within a ToxT‐dependent operon

  1995influential reference
• The OmpU outer membrane protein, a potential adherence factor of Vibrio cholerae

  1995cited by this paper
• Membrane insertion of the bacterial signal transduction protein ToxR and requirements of transcription activation studied by modular replacement of different protein substructures.

  1995cited by this paper
• The accessory colonization factor and toxin-coregulated pilus gene clusters are physically linked on the Vibrio cholerae 0395 chromosome.

  1994cited by this paper
• Analysis of membrane protein interaction: ToxR can dimerize the amino terminus of phage lambda repressor

  1994cited by this paper
• Transcriptional control of toxT, a regulatory gene in the ToxR regulon of Vibrio cholerae

  1994influential reference
• ToxR proteins with substitutions in residues conserved with OmpR fail to activate transcription from the cholera toxin promoter

  1992cited by this paper
• Co‐ordinate expression of virulence genes by ToxR in Vibrio cholerae

  1992influential reference
• A homologue of the Escherichia coli DsbA protein involved in disulphide bond formation is required for enterotoxin biogenesis in Vibrio cholerae

  1992influential reference
• Structural analysis of the acfA and acfD genes of Vibrio cholerae: effects of DNA topology and transcriptional activators on expression

  1992cited by this paper
• Characterization of a periplasmic thiol:disulfide interchange protein required for the functional maturation of secreted virulence factors of Vibrio cholerae.

  1992cited by this paper
• Homology of TcpN, a putative regulatory protein of Vibrio cholerae, to the AraC family of transcriptional activators.

  1992cited by this paper
• The virulence gene activator ToxT from Vibrio cholerae is a member of the AraC family of transcriptional activators

  1992influential reference
• Construction of an eae deletion mutant of enteropathogenic Escherichia coli by using a positive-selection suicide vector

  1991influential reference
• Expression of the Vibrio cholerae gene encoding aldehyde dehydrogenase is under control of ToxR, the cholera toxin transcriptional activator

  1991cited by this paper
• Periplasmic interaction between two membrane regulatory proteins, ToxR and ToxS, results in signal transduction and transcriptional activation.

  1991influential reference
• Regulatory cascade controls virulence in Vibrio cholerae.

  1991influential reference
• Molecular cloning : a laboratory manual. Cold Spring Harbor, NY

  1989cited by this paper
• Characterization of the Vibrio cholerae ToxR Regulon: Identification of Novel Genes Involved in Intestinal Colonization

  1989influential reference
• Determining residue-base interactions between AraC protein and araI DNA.

  1989cited by this paper
• Identification of toxS, a regulatory gene whose product enhances toxR-mediated activation of the cholera toxin promoter

  1989influential reference
• A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR

  1988influential reference
• Toxin, toxin-coregulated pili, and the toxR regulon are essential for Vibrio cholerae pathogenesis in humans

  1988influential reference
• Cholera toxin transcriptional activator toxR is a transmembrane DNA binding protein.

  1987influential reference
• Use of phoA gene fusions to identify a pilus colonization factor coordinately regulated with cholera toxin.

  1987cited by this paper
• Culture Conditions for Stimulating Cholera Toxin Production by Vibrio cholerae O1 El Tor

  1986cited by this paper
• Synthesis of cholera toxin is positively regulated at the transcriptional level by toxR.

  1984influential reference
• Cholera toxin genes: nucleotide sequence, deletion analysis and vaccine development

  1983cited by this paper

• Vibrio cholerae’s ToxRS bile sensing system

  2023cites this paper
• Molecular mechanisms and drivers of pathogen emergence.

  2022cites this paper
• Roles of the second messenger c‐di‐GMP in bacteria: Focusing on the topics of flagellar regulation and Vibrio spp.

  2022cites this paper
• An Enantiodefined Conformationally Constrained Fatty Acid Mimetic and Potent Inhibitor of ToxT.

  2021cites this paper
• The Secretome of Vibrio cholerae

  2021cites this paper
• Structural and DNA-binding properties of the cytoplasmic domain of Vibrio cholerae transcription factor ToxR

  2021cites this paper
• The periplasmic domains of Vibriocholerae ToxR and ToxS are forming a strong heterodimeric complex independent on the redox state of ToxR cysteines

  2020cites this paper
• A disulfide constrains the ToxR periplasmic domain structure, altering its interactions with ToxS and bile-salts

  2020cites this paper
• Application of Genomics to Understand the Pathogenic Microbial Diversity

  2019cites this paper
• Crystal structure of unsaturated fatty acid bound wild-type ToxT from Vibrio cholerae strain SCE256

  2019cites this paper
• Structural basis for virulence regulation in Vibrio cholerae by unsaturated fatty acid components of bile

  2019cites this paper
• Indole Inhibits ToxR Regulon Expression in Vibrio cholerae

  2019cites this paper
• Virulence gene profiles, biofilm formation, and antimicrobial resistance of Vibrio cholerae non-O1/non-O139 bacteria isolated from West Bengal, India

  2018cites this paper
• A Modified ToxT Inhibitor Reduces Vibrio cholerae Virulence in Vivo.

  2018cites this paper
• Protein‐protein interactions as antibiotic targets: A medicinal chemistry perspective

  2018cites this paper
• Infant Mouse Model of Vibrio cholerae Infection and Colonization.

  2018cites this paper
• Proteolysis of ToxR is controlled by cysteine‐thiol redox state and bile salts in Vibrio cholerae

  2018cites this paper
• Multiple intraintestinal signals coordinate the regulation of Vibrio cholerae virulence determinants.

  2018cites this paper
• Environmental Role of Pathogenic Traits in Vibrio cholerae

  2018cites this paper
• Regulatory Hierarchies Controlling Virulence Gene Expression in Shigella flexneri and Vibrio cholerae

  2018cites this paper
• Disarming the enemy: targeting bacterial toxins with small molecules.

  2017cites this paper
• The Fatty Acid Regulator FadR Influences the Expression of the Virulence Cascade in the El Tor Biotype of Vibrio cholerae by Modulating the Levels of ToxT via Two Different Mechanisms

  2017cites this paper
• Structural and Functional Characterization of the FadR Regulatory Protein from Vibrio alginolyticus

  2017cites this paper
• Bile salts and alkaline pH reciprocally modulate the interaction between the periplasmic domains of Vibrio cholerae ToxR and ToxS

  2017cites this paper
• Identification of a Small Molecule Activator for AphB, a LysR-Type Virulence Transcriptional Regulator in Vibrio cholerae.

  2017cites this paper
• The minor pilin TcpB is located at the tip of the toxin co-regulated pilus of Vibrio cholerae and is the receptor for the filamentous phage CTXφ

  2017cites this paper
• A new class of inhibitors of the AraC family virulence regulator Vibrio cholerae ToxT

  2017cites this paper
• Inhibition and Allosteric Signaling of Transcription Activation by Bacterial AraC Family Activator Proteins

  2016influential citation
• 1.65 Å resolution structure of the AraC-family transcriptional activator ToxT from Vibrio cholerae

  2016cites this paper
• Proteolysis of Virulence Regulator ToxR Is Associated with Entry of Vibrio cholerae into a Dormant State

  2015cites this paper
• Role of ToxS in the proteolytic cascade of virulence regulator ToxR in Vibrio cholerae

  2015cites this paper
• Intestinal Colonization Dynamics of Vibrio cholerae

  2015cites this paper
• The Cpx System Regulates Virulence Gene Expression in Vibrio cholerae

  2015cites this paper
• Vibrio cholerae and Escherichia coli heat-labile enterotoxins and beyond

  2015cites this paper
• The Famlily Vibrionaceae

  2014cites this paper
• Computer based screening for novel inhibitors against Vibrio cholerae using NCI diversity set-II: An alternative approach by targeting transcriptional activator ToxT

  2014cites this paper
• The mechanism for inhibition of Vibrio cholerae virulence gene expression by bile and its fatty acid components

  2014influential citation
• Bicarbonate Increases Binding Affinity of Vibrio cholerae ToxT to Virulence Gene Promoters

  2014cites this paper
• Cholera toxin expression by El Tor Vibrio cholerae in shallow culture growth conditions.

  2014cites this paper
• RNA thermometer controls temperature-dependent virulence factor expression in Vibrio cholerae

  2014cites this paper
• mechanisms for bicarbonate-mediated virulence in Vibrio cholerae

  2014influential citation
• Functional Characterization Of The Cholera Toxin Promoter Of vibrio Cholerae

  2013influential citation
• ToxR Recognizes a Direct Repeat Element in the toxT, ompU, ompT, and ctxA Promoters of Vibrio cholerae To Regulate Transcription

  2013influential citation
• Identification of a Small-Molecule Inhibitor of Bacterial AraC Family Activators

  2013cites this paper
• Zanzibar Archipelago of Tanzania Variant Vibrio cholerae Strains in the High-Level-Cholera-Toxin-Producing El Tor Molecular Characterization

  2013cites this paper
• Small-Molecule Inhibitors of toxT Expression in Vibrio cholerae

  2013cites this paper
• Small-Molecule Inhibitor of the Shigella flexneri Master Virulence Regulator VirF

  2013cites this paper
• Toxin and Virulence Regulation in Vibrio cholerae

  2013cites this paper
• Molecular Mechanisms and Inhibition of Transcription Activation by Bacterial AraC Family Activator Proteins

  2013influential citation
• Molecular Characterization of High-Level-Cholera-Toxin-Producing El Tor Variant Vibrio cholerae Strains in the Zanzibar Archipelago of Tanzania

  2013cites this paper
• Φ Vibrio mimicus Strains by CTX Lysogenic Conversion of Environmental

  2013cites this paper
• Structural and functional importance of outer membrane proteins in Vibrio cholerae flagellum

  2012cites this paper
• Characterization of BreR Interaction with the Bile Response Promoters breAB and breR in Vibrio cholerae

  2012cites this paper
• The crystal structure of AphB, a virulence gene activator from Vibrio cholerae, reveals residues that influence its response to oxygen and pH

  2012cites this paper
• MetR-Regulated Vibrio cholerae Metabolism Is Required for Virulence

  2012cites this paper
• Identifizierung von Substanzen zur Verminderung der Pathogenität von Vibrio cholerae durch neuentwickelte Hochdurchsatz-Screeningverfahren

  2012cites this paper
• Disulfide Bond Formation and ToxR Activity in Vibrio cholerae

  2012cites this paper
• Characterization of TarA, a ToxT-activated Small Regulatory RNA Produced by Vibrio cholerae.

  2012cites this paper
• Characterization of Vibrio cholerae O1 El Tor Biotype Variant Clinical Isolates from Bangladesh and Haiti, Including a Molecular Genetic Analysis of Virulence Genes

  2011cites this paper
• Termination of Vibrio cholerae virulence gene expression is mediated by proteolysis of the major virulence activator, ToxT

  2011cites this paper
• The two faces of ToxR: activator of ompU, co‐regulator of toxT in Vibrio cholerae

  2011cites this paper
• N-terminal Residues of the Vibrio cholerae Virulence Regulatory Protein ToxT Involved in Dimerization and Modulation by Fatty Acids*

  2011cites this paper
• primer name sequence 5’ to 3’ purpose 5’ ToxR-HA gggggatcctcaaaagagatatcgatgag cloning toxR into pcDNA-HA and pSK Bluescript 3’ ToxR-HA ggggggctcgagctcacacactttgatggc cloning toxR into pcDNA-HA 3’ HA-tag ApaI cctgacgggcccactagcgaattcatctagaagcg cloning toxR into pSK Bluescript toxR K85R TOP catttcga

  2011cites this paper
• TagA is a secreted protease of Vibrio cholerae that specifically cleaves mucin glycoproteins

  2011cites this paper
• Structure of Vibrio cholerae ToxT reveals a mechanism for fatty acid regulation of virulence genes

  2010cites this paper
• Post-transcriptional regulation of vibrio cholerae virulence activator toxt

  2010influential citation
• The LysR-Type Virulence Activator AphB Regulates the Expression of Genes in Vibrio cholerae in Response to Low pH and Anaerobiosis

  2010cites this paper
• A Systems Biology Approach To Modeling Vibrio cholerae Gene Expression under Virulence-Inducing Conditions

  2010influential citation
• Small Molecule Inhibitors of LcrF, a Yersinia pseudotuberculosis Transcription Factor, Attenuate Virulence and Limit Infection in a Murine Pneumonia Model

  2010cites this paper
• The Vibrio cholerae virulence regulatory cascade controls glucose uptake through activation of TarA, a small regulatory RNA

  2010cites this paper
• H-NS Binding and Repression of the ctx Promoter in Vibrio cholerae

  2010influential citation
• Chemical tools for dissecting bacterial physiology and virulence.

  2009cites this paper
• Chronic Carriage of Salmonella : Biofilms and Gallstones

  2009cites this paper
• Distribution and sequence analysis of virulence associated genes in Vibrio cholerae O1, O139 and non-O1/non-O139 isolates from Thailand.

  2009cites this paper
• The interaction of bile salts with pathogenic and nonpathogenic intestinal bacteria.

  2009cites this paper
• Bicarbonate Induces Vibrio cholerae Virulence Gene Expression by Enhancing ToxT Activity

  2009cites this paper
• Toxigenic Vibrio cholerae strains and their associated malaises

  2009cites this paper
• Direct Regulation by the Vibrio cholerae Regulator ToxT To Modulate Colonization and Anticolonization Pilus Expression

  2009cites this paper
• N-hydroxybenzimidazole inhibitors of the transcription factor LcrF in Yersinia: novel antivirulence agents.

  2009cites this paper
• Integration Host Factor Positively Regulates Virulence Gene Expression in Vibrio cholerae

  2008cites this paper
• Oral Microbiology: Environmental cues and gene expression in Porphyromonas gingivalis and Actinobacillus actinomycetemcomitans

  2008cites this paper
• Flexibility of Vibrio cholerae ToxT in Transcription Activation of Genes Having Altered Promoter Spacing

  2008cites this paper
• Regulation of virulence in Vibrio cholerae: the ToxR regulon.

  2007cites this paper
• Identification of residues critical for the function of the Vibrio cholerae virulence regulator ToxT by scanning alanine mutagenesis.

  2007cites this paper
• Novel anti-infection agents: small-molecule inhibitors of bacterial transcription factors.

  2007cites this paper
• The quorum sensing regulator HapR downregulates the expression of the virulence gene transcription factor AphA in Vibrio cholerae by antagonizing Lrp‐ and VpsR‐mediated activation

  2007cites this paper
• Molecular mechanisms of virstatin resistance by non‐O1/non‐O139 strains of Vibrio cholerae

  2007cites this paper
• Quantification of human pathogenic Vibrios in seafood using molecular techniques

  2007cites this paper
• MarA, SoxS and Rob function as virulence factors in an Escherichia coli murine model of ascending pyelonephritis.

  2006cites this paper
• Two-Component Signal Transduction Systems, Environmental Signals, and Virulence

  2006cites this paper
• Differences in Gene Expression between the Classical and El Tor Biotypes of Vibrio cholerae O1

  2006influential citation
• Vibrio cholerae: the genetics of pathogenesis and environmental persistence.

  2006cites this paper
• The toxbox: specific DNA sequence requirements for activation of Vibrio cholerae virulence genes by ToxT

  2006cites this paper
• Genomics and the Evolution of Pathogenic Vibrio cholerae

  2006cites this paper
• CHAPTER 15 – Vibrio cholerae and Escherichia coli thermolabile enterotoxin

  2006cites this paper
• Vibrio cholerae ToxT Independently Activates the Divergently Transcribed aldA and tagA Genes

  2005cites this paper
• Cyclic Diguanylate Regulates Vibrio cholerae Virulence Gene Expression

  2005influential citation
• Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation

  2005cites this paper
• Characterizing lipopolysaccharide and core lipid A mutant O1 and O139 Vibrio cholerae strains for adherence properties on mucus-producing cell line HT29-Rev MTX and virulence in mice.

  2005cites this paper
• Bile acids induce cholera toxin expression in Vibrio cholerae in a ToxT-independent manner.

  2005cites this paper