Light-dependent regulation of ascorbate in tomato by a monodehydroascorbate reductase localized in peroxisomes and the cytosol.

No abstract is available for this paper.

• Publication year

  2013

• Venue

  Plant Biotechnology Journal

• Publication date

  2013-04-01

• Fields of study

  Biology, Medicine, Environmental Science

• Identifiers
  DOI 10.1111/pbi.12020PMID 23130940
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• A diminution in ascorbate oxidase activity affects carbon allocation and improves yield in tomato under water deficit.

  2013cited by this paper
• Enhancing ascorbate in fruits and tubers through over-expression of the L-galactose pathway gene GDP-L-galactose phosphorylase.

  2012cited by this paper
• Light affects ascorbate content and ascorbate-related gene expression in tomato leaves more than in fruits

  2011cited by this paper
• Role of peroxidases in the compensation of cytosolic ascorbate peroxidase knockdown in rice plants under abiotic stress.

  2011cited by this paper
• Constitutively expressed DHAR and MDHAR influence fruit, but not foliar ascorbate levels in tomato.

  2011cited by this paper
• Ascorbate and Glutathione: The Heart of the Redox Hub1

  2011cited by this paper
• A salt-inducible chloroplastic monodehydroascorbate reductase from halophyte Avicennia marina confers salt stress tolerance on transgenic plants.

  2010cited by this paper
• Arabidopsis glutathione reductase 1 is dually targeted to peroxisomes and the cytosol

  2010cited by this paper
• Enhanced ascorbic acid accumulation in transgenic potato confers tolerance to various abiotic stresses

  2010cited by this paper
• Overexpression of chloroplastic monodehydroascorbate reductase enhanced tolerance to temperature and methyl viologen-mediated oxidative stresses.

  2010cited by this paper
• Perfluorodecalin enhances in vivo confocal microscopy resolution of Arabidopsis thaliana mesophyll.

  2010cited by this paper
• The Role of Dehydroascorbate in Disulfide Bond Formation

  2010cited by this paper
• AMR1, an Arabidopsis Gene That Coordinately and Negatively Regulates the Mannose/l-Galactose Ascorbic Acid Biosynthetic Pathway1[OA]

  2009cited by this paper
• Regulation of tomato fruit ascorbate content is more highly dependent on fruit irradiance than leaf irradiance.

  2009cited by this paper
• Tomato fruit ascorbic acid content is linked with monodehydroascorbate reductase activity and tolerance to chilling stress.

  2008cited by this paper
• L-Ascorbate biosynthesis in higher plants: the role of VTC2.

  2008cited by this paper
• Increase in ascorbate content of transgenic tobacco plants overexpressing the acerola (Malpighia glabra) phosphomannomutase gene.

  2008cited by this paper
• Analysis of GDP-D-mannose pyrophosphorylase gene promoter from acerola (Malpighia glabra) and increase in ascorbate content of transgenic tobacco expressing the acerola gene.

  2008cited by this paper
• A multicolored set of in vivo organelle markers for co-localization studies in Arabidopsis and other plants.

  2007cited by this paper
• Candidate Genes and Quantitative Trait Loci Affecting Fruit Ascorbic Acid Content in Three Tomato Populations

  2007cited by this paper
• Two genes in Arabidopsis thaliana encoding GDP-L-galactose phosphorylase are required for ascorbate biosynthesis and seedling viability.

  2007cited by this paper
• Overexpression of monodehydroascorbate reductase in transgenic tobacco confers enhanced tolerance to ozone, salt and polyethylene glycol stresses

  2007cited by this paper
• Technique for rapid, small-scale analysis of vitamin C levels in fruit and application to a tomato mutant collection.

  2006cited by this paper
• Progress in manipulating ascorbic acid biosynthesis and accumulation in plants

  2006cited by this paper
• Arabidopsis peroxisomes possess functionally redundant membrane and matrix isoforms of monodehydroascorbate reductase.

  2005cited by this paper
• The Mitochondrial Type II Peroxiredoxin F Is Essential for Redox Homeostasis and Root Growth of Arabidopsis thaliana under Stress*

  2005cited by this paper
• Improving the nutritional value of crops through enhancement of L-ascorbic acid (vitamin C) content: rationale and biotechnological opportunities.

  2005cited by this paper
• Peroxisomal Monodehydroascorbate Reductase. Genomic Clone Characterization and Functional Analysis under Environmental Stress Conditions1

  2005cited by this paper
• Gene Structure and Expression Pattern Analysis of Three Monodehydroascorbate Reductase (Mdhar) Genes in Physcomitrella patens: Implications for the Evolution of the MDHAR Family in Plants*

  2005cited by this paper
• Specification of the Peroxisome Targeting Signals Type 1 and Type 2 of Plant Peroxisomes by Bioinformatics Analyses1[w]

  2004cited by this paper
• Feedback inhibition of spinach L-galactose dehydrogenase by L-ascorbate.

  2004cited by this paper
• Vitamin C Is a Kinase Inhibitor: Dehydroascorbic Acid Inhibits IκBα Kinase β

  2004cited by this paper
• Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein

  2004cited by this paper
• A Gateway Cloning Vector Set for High-Throughput Functional Analysis of Genes in Planta[w]

  2003cited by this paper
• GDP-Mannose 3′,5′-Epimerase Forms GDP-L-gulose, a Putative Intermediate for the de Novo Biosynthesis of Vitamin C in Plants*

  2003cited by this paper
• Increasing vitamin C content of plants through enhanced ascorbate recycling

  2003cited by this paper
• Engineering increased vitamin C levels in plants by overexpression of a D-galacturonic acid reductase

  2003cited by this paper
• Vitamin C inhibits granulocyte macrophage-colony-stimulating factor-induced signaling pathways.

  2002cited by this paper
• Drought and oxidative load in the leaves of C3 plants: a predominant role for photorespiration?

  2002cited by this paper
• GATEWAY vectors for Agrobacterium-mediated plant transformation.

  2002cited by this paper
• A randomized, placebo-controlled, clinical trial of high-dose supplementation with vitamins C and E, beta carotene, and zinc for age-related macular degeneration and vision loss: AREDS report no. 8.

  2001cited by this paper
• The control of ascorbic acid synthesis and turnover in pea seedlings.

  2000cited by this paper
• Ascorbic Acid in Plants: Biosynthesis and Function

  2000cited by this paper
• Ascorbic acid: metabolism and functions of a multi-facetted molecule.

  2000cited by this paper
• Stimulation of the pentose phosphate pathway and glutathione levels by dehydroascorbate, the oxidized form of vitamin C

  2000cited by this paper
• Ascorbic Acid in Plants: Biosynthesis and Function

  2000cited by this paper
• Lymphocyte proliferation modulated by glutamine: involved in the endogenous redox reaction

  1999cited by this paper
• ASCORBATE AND GLUTATHIONE: Keeping Active Oxygen Under Control.

  1998cited by this paper
• The vitamin C radical and its reactions.

  1997cited by this paper
• Protein Oxidation in Aging, Disease, and Oxidative Stress*

  1997cited by this paper
• Transgenic tobacco plants expressing antisense RNA for cytosolic ascorbate peroxidase show increased susceptibility to ozone injury

  1997cited by this paper
• Acclimation of leaf carotenoid composition and ascorbate levels to gradients in the light environment within an Australian rainforest

  1996cited by this paper
• Ascorbate Free Radical Reductase mRNA Levels Are Induced by Wounding

  1995cited by this paper
• A Direct Demonstration of the Catalytic Action of Monodehydroascorbate Reductase by Pulse Radiolysis (*)

  1995cited by this paper
• An activated-oxygen-mediated role for peroxisomes in the mechanism of senescence of Pisum sativum L. leaves

  1994cited by this paper
• Re-evaluation of Conditions for Plant Regeneration and Agrobacterium-Mediated Transformation from Tomato (Lycopersicon esculentum)

  1993cited by this paper
• The oxidant stress hypothesis in Parkinson's disease: Evidence supporting it

  1992cited by this paper
• Localization of manganese superoxide dismutase in peroxisomes isolated from Pisum sativum L.

  1987cited by this paper

• Development of transgenic wheat plants withstand salt stress via the MDAR1 gene

  2025cites this paper
• Improving Crop Tolerance to Abiotic Stress for Sustainable Agriculture: Progress in Manipulating Ascorbic Acid Metabolism via Genome Editing

  2025cites this paper
• Cytosolic Monodehydroascorbate Reductase 2 Promotes Oxidative Stress Signaling in Arabidopsis

  2025cites this paper
• Regulation of nitro-oxidative homeostasis: an effective approach to enhance salinity tolerance in plants

  2024cites this paper
• Biofortification for space farming: Maximising nutrients using lettuce as a model plant

  2024cites this paper
• Evolutionary insights into strategy shifts for the safe and effective accumulation of ascorbate in plants.

  2024cites this paper
• Molecular evolution and interaction of ROS with ion transport for plant abiotic stresses

  2024cites this paper
• Expression of the alfalfa gene MsMDHAR in Arabidopsis thaliana increases water stress tolerance.

  2024cites this paper
• Chloroplast dehydroascorbate reductase and glutathione cooperatively determine the capacity for ascorbate accumulation under photooxidative stress conditions.

  2023cites this paper
• Kiwifruit Monodehydroascorbate Reductase 3 Gene Negatively Regulates the Accumulation of Ascorbic Acid in Fruit of Transgenic Tomato Plants

  2023cites this paper
• Beneficial effects of red and blue light on potato leaf antioxidant capacity and tuber bulking

  2023cites this paper
• L-Ascorbic acid metabolism and regulation in fruit crops.

  2023cites this paper
• γ-Aminobutyric acid treatment induced chilling tolerance in postharvest kiwifruit (Actinidia chinensis cv. Hongyang) via regulating ascorbic acid metabolism.

  2022cites this paper
• Light Intensity- and Spectrum-Dependent Redox Regulation of Plant Metabolism

  2022cites this paper
• Metabolism and Regulation of Ascorbic Acid in Fruits

  2022cites this paper
• Correlation of Ascorbic Acid Content and the Pattern of Monodehydroascorbate Reductases (MDHARs) Gene Expression in Leek (Allium porrum L.)

  2021cites this paper
• Prospects to improve the nutritional quality of crops

  2021cites this paper
• Engineering of Plant Metabolic Pathway for Nutritional Improvement

  2021cites this paper
• Genome-Wide Analysis of MDHAR Gene Family in Four Cotton Species Provides Insights into Fiber Development via Regulating AsA Redox Homeostasis

  2021cites this paper
• Ozone uptake at night is more damaging to plants than equivalent day-time flux

  2021cites this paper
• Assessing the effect of P-solubilizing bacteria and mycorrhizal fungi on tomato yield and quality under different crop rotations

  2021cites this paper
• Distribution and Functions of Monodehydroascorbate Reductases in Plants: Comprehensive Reverse Genetic Analysis of Arabidopsis thaliana Enzymes

  2021cites this paper
• The pivotal function of dehydroascorbate reductase in glutathione homeostasis in plants.

  2020cites this paper
• The cytosolic invertase NI6 affects vegetative growth, flowering, fruit set and yield in tomato.

  2020cites this paper
• Benefiting others and self: Production of vitamins in plants.

  2020cites this paper
• Salicylic acid-induced differential resistance to the Tomato yellow leaf curl virus among resistant and susceptible tomato cultivars

  2019cites this paper
• Biosynthetic Gene Pyramiding Leads to Ascorbate Accumulation with Enhanced Oxidative Stress Tolerance in Tomato

  2019cites this paper
• Abiotic stress-induced regulation of antioxidant genes in different Arabidopsis ecotypes: microarray data evaluation

  2019cites this paper
• Lyophilized tomato plant material: Validation of a reliable extraction method for the analysis of vitamin C

  2019cites this paper
• Vitamin C in fleshy fruits: biosynthesis, recycling, genes, and enzymes

  2019cites this paper
• Get the Balance Right: ROS Homeostasis and Redox Signalling in Fruit

  2019cites this paper
• Vitamin C in Plants: From Functions to Biofortification

  2019cites this paper
• Antioxidants and Antioxidant Enzymes in Higher Plants

  2018influential citation
• Is monodehydroascorbate reductase activity in leaf tissue critical for the maintenance of yield in tomato?

  2018cites this paper
• Function of the Various MDAR Isoforms in Higher Plants

  2018cites this paper
• A Systems Biology Study in Tomato Fruit Reveals Correlations between the Ascorbate Pool and Genes Involved in Ribosome Biogenesis, Translation, and the Heat-Shock Response

  2018cites this paper
• Differentially expressed protein and gene analysis revealed the effects of temperature on changes in ascorbic acid metabolism in harvested tea leaves

  2018cites this paper
• Ascorbate concentration in Arabidopsis thaliana and expression of ascorbate related genes using RNAseq in response to light and the diurnal cycle

  2017cites this paper
• The Role of Plant High-Throughput Phenotyping in the Characterization of the Response of High Ascorbate Plants to Abiotic Stresses

  2017cites this paper
• Ascorbate degradation in tomato leads to accumulation of oxalate, threonate and oxalyl threonate

  2017cites this paper
• Molecular cloning, in-silico characterization and functional validation of monodehydroascorbate reductase gene in Eleusine coracana

  2017cites this paper
• Cytosolic and Chloroplastic DHARs Cooperate in Oxidative Stress-Driven Activation of the Salicylic Acid Pathway1[OPEN]

  2017cites this paper
• Manipulation of Metabolic Pathways to Develop Vitamin-Enriched Crops for Human Health

  2017cites this paper
• Transcriptomic analysis of the biosynthesis, recycling, and distribution of ascorbic acid during leaf development in tea plant (Camellia sinensis (L.) O. Kuntze)

  2017cites this paper
• Light regulates ascorbate in plants: An integrated view on physiology and biochemistry

  2017cites this paper
• Plant ascorbate influence on cell division, growth and seed production of Arabidopsis Thaliana

  2017cites this paper
• Integrated bioinformatics to decipher the ascorbic acid metabolic network in tomato

  2016cites this paper
• Water stress and higher plants

  2016cites this paper
• The regulation of ascorbate biosynthesis.

  2016cites this paper
• Transcriptional profiling of genes involved in ascorbic acid biosynthesis, recycling, and degradation during three leaf developmental stages in celery

  2016cites this paper
• Reduction of MDHAR activity in cherry tomato suppresses growth and yield and MDHAR activity is correlated with sugar levels under high light.

  2016cites this paper
• Ascorbic Acid-Related Genes

  2016cites this paper
• Ascorbate–Glutathione Cycle: Controlling the Redox Environment for Drought Tolerance

  2016cites this paper
• Drought Stress Tolerance in Plants, Vol 1

  2016cites this paper
• Changes on Antioxidant Metabolites and Enzymes in Soybean Inoculated and Treated with Fungicides

  2016cites this paper
• Light avoidance reduces ascorbic acid accumulation in the peel of Citrus fruit.

  2015cites this paper
• Transcriptome Profiling of Tomato Fruit Development Reveals Transcription Factors Associated with Ascorbic Acid, Carotenoid and Flavonoid Biosynthesis

  2015cites this paper
• Ascorbate peroxidase from Jatropha curcas enhances salt tolerance in transgenic Arabidopsis.

  2015cites this paper
• Regulation of ascorbic acid biosynthesis and recycling during root development in carrot (Daucus carota L.).

  2015cites this paper
• Stress and signalling in Arabidopsis in response to the pollutant 2,4,6-trinitrotoluene (TNT)

  2015cites this paper
• IN CONTEXT : PART OF A SPECIAL ISSUE ON REACTIVE OXYGEN AND NITROGEN SPECIES Physiology of pepper fruit and the metabolism of antioxidants : chloroplasts , mitochondria and peroxisomes

  2015cites this paper
• RESEARCH IN CONTEXT: PART OF A SPECIAL ISSUE ON REACTIVE OXYGEN SPECIES AND NITRIC OXIDE Physiology of pepper fruit and the metabolism of antioxidants: chloroplasts, mitochondria and peroxisomes

  2015cites this paper
• Oxydation et dégradation de l'ascorbate chez la tomate et impact sur la croissance et le métabolisme

  2015influential citation
• Variation in Tomato Fruit Ascorbate Levels and Consequences of Manipulation of Ascorbate Metabolism on Drought Stress Tolerance

  2014cites this paper
• Engineering Elevated Vitamin C in Plants to Improve their Nutritional Content, Growth, and Tolerance to Abiotic Stress

  2014cites this paper
• Purification, characterization and preliminary X-ray crystallographic studies of monodehydroascorbate reductase from Oryza sativa L. japonica.

  2014cites this paper
• Overexpression of the Monodehydroascorbate Reductase Gene from Non-heading Chinese Cabbage Reduces Ascorbate Level and Growth in Transgenic Tobacco

  2014influential citation
• An update: improvements in imaging perfluorocarbon-mounted plant leaves with implications for studies of plant pathology, physiology, development and cell biology

  2014cites this paper
• Strategies to increase vitamin C in plants: from plant defense perspective to food biofortification

  2013cites this paper
• Decreased monodehydroascorbate reductase activity reduces tolerance to cold storage in tomato and affects fruit antioxidant levels

  2013cites this paper
• An update: improvements in imaging perfluorocarbon-mounted An update: improvements in imaging perfluorocarbon-mounted plant leaves with implications for studies of plant pathology, plant leaves with implications for studies of plant pathology, physiology, development and cell biology physiology, dev

  year unknowncites this paper
• CGCTACGATGTTACTGCCTGTGA CACCTCTTCCTGCCCAACTTTAGT DcGGP 2 CCTCGTGTTCTTGAGTGCTTACCA GTAGTATGCCTGGAAGTGAAGGTGATT DcGPP AACTGCTGCCAAGACTGGTTCTG ATGAATCTCCTATAAGCCCTCCTTCCT DcGalDH CCACCAGGCACCGTAGATGTAATC ATCACACCAACACCTTTGCTCTTCA DcGalLDH AGGTGGATAAGGAGAGGAAGATTGTG ACTGTGTCGGTATATGGTATGTAGAGA DcGalUR A

  year unknowncites this paper