The spätzle gene encodes a component of the extracellular signaling pathway establishing the dorsal-ventral pattern of the Drosophila embryo.

No abstract is available for this paper.

• Publication year

  1994

• Venue

  Cell

• Publication date

  1994-02-25

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1016/0092-8674(94)90507-XPMID 8124709
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Polymerase chain reaction.

  1996cited by this paper
• Binding affinities and cooperative interactions with bHLH activators delimit threshold responses to the dorsal gradient morphogen.

  1993cited by this paper
• Genetic characterization of tube and pelle, genes required for signaling between Toll and dorsal in the specification of the dorsal-ventral pattern of the Drosophila embryo.

  1993cited by this paper
• A structural superfamily of growth factors containing a cystine knot motif.

  1993cited by this paper
• Multiple extracellular activities in Drosophila egg perivitelline fluid are required for establishment of embryonic dorsal-ventral polarity.

  1992cited by this paper
• Decapentaplegic acts as a morphogen to organize dorsal-ventral pattern in the Drosophila embryo.

  1992cited by this paper
• Activation of the easter zymogen is regulated by five other genes to define dorsal-ventral polarity in the Drosophila embryo.

  1992cited by this paper
• NF-kappa B and related proteins: Rel/dorsal homologies meet ankyrin-like repeats.

  1992cited by this paper
• NF-κB and related proteins: Rel/dorsal homologies meet ankyrin-like repeats

  1992cited by this paper
• Dominant and recessive mutations define functional domains of Toll, a transmembrane protein required for dorsal-ventral polarity in the Drosophila embryo.

  1991cited by this paper
• The dorsal morphogen gradient regulates the mesoderm determinant twist in early Drosophila embryos.

  1991cited by this paper
• The dorsal morphogen is a sequence-specific DNA-binding protein that interacts with a long-range repression element in Drosophila.

  1991cited by this paper
• Plasma membrane localization of the Toll protein in the syncytial Drosophila embryo: importance of transmembrane signaling for dorsal-ventral pattern formation.

  1991cited by this paper
• Functional analysis of the Drosophila twist promoter reveals a dorsal-binding ventral activator region.

  1991cited by this paper
• The control of cell fate along the dorsal-ventral axis of the Drosophila embryo.

  1991cited by this paper
• Sequence-specific transactivation of the Drosophila twist gene by the dorsal gene product.

  1991cited by this paper
• The polarity of the dorsoventral axis in the Drosophila embryo is defined by an extracellular signal.

  1991cited by this paper
• Dominant and recessive alleles of the Drosophila easter gene are point mutations at conserved sites in the serine protease catalytic domain.

  1990cited by this paper
• cappuccino and spire: two unique maternal-effect loci required for both the anteroposterior and dorsoventral patterns of the Drosophila embryo.

  1989cited by this paper
• The graded distribution of the dorsal morphogen is initiated by selective nuclear transport in Drosophila.

  1989cited by this paper
• The role of easter, an apparent serine protease, in organizing the dorsal-ventral pattern of the Drosophila embryo.

  1989cited by this paper
• Relocalization of the dorsal protein from the cytoplasm to the nucleus correlates with its function.

  1989cited by this paper
• A gradient of nuclear localization of the dorsal protein determines dorsoventral pattern in the Drosophila embryo.

  1989cited by this paper
• A stable genomic source of P element transposase in Drosophila melanogaster.

  1988cited by this paper
• Functional cDNA libraries from Drosophila embryos.

  1988cited by this paper
• The Toll gene of Drosophila, required for dorsal-ventral embryonic polarity, appears to encode a transmembrane protein.

  1988cited by this paper
• Injection of wild-type cytoplasm and poly(A)+ RNA provokes phenotype rescue in spätzle mutant Drosophila embryos

  1987cited by this paper
• Dorsal, an embryonic polarity gene in Drosophila, is homologous to the vertebrate proto-oncogene, c-rel.

  1987cited by this paper
• Unidirectional digestion with exonuclease III in DNA sequence analysis.

  1987cited by this paper
• A gene required for the specification of dorsal-ventral pattern in Drosophila appears to encode a serine protease

  1986cited by this paper
• Assembly of the mitochondrial membrane system. CBP6, a yeast nuclear gene necessary for synthesis of cytochrome b.

  1985cited by this paper
• Establishment of dorsal-ventral polarity in the Drosophila embryo: genetic studies on the role of the Toll gene product.

  1985cited by this paper
• Establishment of dorsal-ventral polarity in the Drosophila embryo: the induction of polarity by the Toll gene product.

  1985cited by this paper
• Signal sequences. The limits of variation.

  1985cited by this paper
• Signal sequences: The limits of variation

  1985cited by this paper
• Lambda replacement vectors carrying polylinker sequences.

  1983cited by this paper
• Physical map of the white locus of Drosophila melanogaster.

  1982cited by this paper
• Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.

  1979cited by this paper
• DNA sequencing with chain-terminating inhibitors.

  1977cited by this paper

• Application of Proteins Binding Components of Bacterial Cell Wall for Extraction, Concentration, and Analysis of Biological Samples

  2026cites this paper
• Functions of Drosophila Toll/NF-κB signaling in imaginal tissue homeostasis and cancer

  2025cites this paper
• My Life as a Scientist: From RNA Polymerase to the Evolution of Beauty.

  2025cites this paper
• Calpain Proteases and the Evolving Signaling Network in Insect Embryonic Patterning.

  2025cites this paper
• Suppression of Drosophila antifungal immunity by a parasite effector via blocking GNBP3 and GNBP-like 3, the dual receptors for β-glucans.

  2024cites this paper
• Cephalic ganglia transcriptomics of the American cockroach Periplaneta americana (Blattodea: Blattidae)

  2024cites this paper
• RNA sequencing analysis uncovers the role of aldehyde oxidase TcAOX2 in regulating toxic substance susceptibility in the red flour beetle, Tribolium castaneum

  2024cites this paper
• Evolutionary immunology to explore original antiviral strategies

  2024cites this paper
• Damage sensing mediated by serine proteases Hayan and Persephone for Toll pathway activation in apoptosis-deficient flies

  2023cites this paper
• A Novel Drosophila Model to Investigate Adipose Tissue Macrophage Infiltration (ATM) and Obesity highlights the Therapeutic Potential of Attenuating Eiger/TNFα Signaling to Ameliorate Insulin Resistance and ATM

  2023cites this paper
• Induced expression modes of genes related to Toll, Imd, and JAK/STAT signaling pathway-mediated immune response in Spodoptera frugiperda infected with Beauveria bassiana

  2023cites this paper
• Imidacloprid and acetamiprid synergistically downregulate spaetzle and myD88 of the Toll pathway in haemocytes of the European honeybee (Apis mellifera).

  2023cites this paper
• DEVELOPMENT OF BIOLOGICAL CONTROL OF ORIENTAL FRUIT MOTH AND INSECT IMMUNE RESPONSE INDUCED BY ENTOMOPATHOGENIC FUNGI

  2023cites this paper
• Determining zebrafish dorsal organizer size by a negative feedback loop between canonical/non-canonical Wnts and Tlr4/NFκB

  2023cites this paper
• Finishing the egg.

  2023cites this paper
• A Drosophila model targets Eiger/TNFα to alleviate obesity-related insulin resistance and macrophage infiltration

  2023cites this paper
• Double-strand RNAs targeting MaltRelish and MaltSpz reveals potential targets for pest management of Monochamus alternatus.

  2023cites this paper
• The role of micro RNAs (miRNAs) in the regulation of Drosophila melanogaster’s innate immunity

  2022cites this paper
• Drosophila Innate Immunity Involves Multiple Signaling Pathways and Coordinated Communication Between Different Tissues

  2022cites this paper
• Species-informative SNP markers for characterising freshwater prawns of genus Macrobrachium in Cameroon

  2022cites this paper
• Expression and Function of Toll Pathway Components in the Early Development of the Wasp Nasonia vitripennis

  2022cites this paper
• Drosophila hemocytes recognize lymph gland tumors of mxc mutants and activate the innate immune pathway in a reactive oxygen species-dependent manner

  2022cites this paper
• The nested embryonic dorsal domains of BMP‐target genes are not scaled to size during the evolution of Drosophila species

  2022cites this paper
• Drosophila as a Model Organism to Study Basic Mechanisms of Longevity

  2022cites this paper
• Advances in the Immune Regulatory Role of Non-Coding RNAs (miRNAs and lncRNAs) in Insect-Pathogen Interactions

  2022cites this paper
• Proteolytic activation of Growth-blocking peptides triggers calcium responses through the GPCR Mthl10 during epithelial wound detection.

  2021cites this paper
• Regulators and signalling in insect antimicrobial innate immunity: Functional molecules and cellular pathways.

  2021cites this paper
• Drosophila hemocytes recognize lymph gland tumors of mxc mutants and activate the Toll pathway in reactive oxygen species-dependent manner

  2021cites this paper
• Toll family members bind multiple Spatzle proteins and activate Toll family members bind multiple Spatzle proteins and activate antimicrobial peptide gene expression in Drosophila antimicrobial peptide gene expression in Drosophila

  2021cites this paper
• Kathryn Anderson (1952-2020).

  2021cites this paper
• In Memoriam: Kathryn V. Anderson (1952-2020).

  2021cites this paper
• The Drosophila miR-959–962 Cluster Members Repress Toll Signaling to Regulate Antibacterial Defense during Bacterial Infection

  2021cites this paper
• Sleep: Astrocytes Take Their Toll on Tired Flies.

  2021cites this paper
• Genetic determinants of antiviral immunity in dipteran insects - compiling the experimental evidence.

  2021cites this paper
• The Toll gene in Drosophila pattern formation.

  2021cites this paper
• A protease-initiated model of wound detection

  2020cites this paper
• NineTeen Complex-subunit Salsa is required for efficient splicing of a subset of introns and dorsal–ventral patterning

  2020cites this paper
• Signaling between somatic follicle cells and the germline patterns the egg and embryo of Drosophila.

  2020cites this paper
• Aedes aegypti (Diptera: Culicidae) Immune Responses with Different Feeding Regimes Following Infection by the Entomopathogenic Fungus Metarhizium anisopliae

  2020cites this paper
• Toll-9 interacts with Toll-1 to mediate a feedback loop during apoptosis-induced proliferation in Drosophila

  2020cites this paper
• Comparative transcriptome analyses of the Drosophila pupal eye

  2020cites this paper
• Anticancer agents found in environment affect Daphnia at population, individual and molecular levels.

  2019cites this paper
• Molecular isolation and characterization of a spätzle gene from Macrobrachium rosenbergii.

  2019cites this paper
• Anti-tumour effects of antimicrobial peptides, components of the innate immune system, against haematopoietic tumours in Drosophila mxc mutants

  2019cites this paper
• Toll family members bind multiple Spätzle proteins and activate antimicrobial peptide gene expression in Drosophila

  2019cites this paper
• Antimicrobial peptides from Bombyx mori: a splendid immune defense response in silkworms

  2019cites this paper
• Isolation of secreted proteins from Drosophila ovaries and embryos through in vivo BirA-mediated biotinylation

  2019cites this paper
• Dynamics of Spaetzle morphogen shuttling in the Drosophila embryo shapes gastrulation patterning

  2019cites this paper
• Anti-tumor effects of antimicrobial peptides, targets of the innate immune system, against hematopoietic tumors in Drosophila mxc mutants

  2018cites this paper
• Sumo in development: lessons from drosophila with comparisons to mammals

  2018cites this paper
• Understanding the Role of Innate Immunity in the Response to Intracortical Microelectrodes.

  2018cites this paper
• Dynamics of Spaetzle morphogen shuttling in the Drosophila embryo shapes pattern

  2018cites this paper
• Mosquito Innate Immunity

  2018cites this paper
• Spatially restricted regulation of cell competition by the cytokine Spaetzle

  2018cites this paper
• The trigger (and the restriction) of Torso RTK activation

  2018cites this paper
• The Fly Way of Antiviral Resistance and Disease Tolerance.

  2018cites this paper
• Spatzle4 gene of silkworm, Bombyx mori: identification, immune response, and the effect of RNA interference on the antimicrobial peptides’ expression in the integument

  2018cites this paper
• Sexual dimorphism in Drosophila melanogaster survival of Beauveria bassiana infection depends on core immune signaling

  2018cites this paper
• Molecular cloning and analysis of PGRP-L1 and IMD from silkworm Bombyx mori.

  2018cites this paper
• Multiple Toll-Spätzle Pathways in Drosophila melanogaster Immunity

  2018influential citation
• The Toll Pathway in the Central Nervous System of Flies and Mammals

  2018cites this paper
• Spatially Restricted Regulation of Spätzle/Toll Signaling during Cell Competition.

  2018cites this paper
• Rapidly Evolving Toll-3/4 Genes Encode Male-Specific Toll-Like Receptors in Drosophila

  2017cites this paper
• NF-κB-Like Signaling Pathway REL2 in Immune Defenses of the Malaria Vector Anopheles gambiae

  2017cites this paper
• MACPF/CDC proteins in development: Insights from Drosophila torso-like.

  2017cites this paper
• Reconstitution of Torso signaling in cultured cells suggests a role for both Trunk and Torso-like in receptor activation

  2017cites this paper
• The Toll pathway underlies host sexual dimorphism in resistance to both Gram-negative and Gram-positive bacteria in mated Drosophila

  2017cites this paper
• Identification and functional characterization of a novel Spätzle gene in Litopenaeus vannamei

  2017cites this paper
• A novel mode of induction of the humoral innate immune response in Drosophila larvae

  2017cites this paper
• Next-Generation Sequencing and the Crustacean Immune System: The Need for Alternatives in Immune Gene Annotation.

  2016cites this paper
• The Toll Signaling Pathway in the Chinese Oak Silkworm, Antheraea pernyi: Innate Immune Responses to Different Microorganisms

  2016cites this paper
• Mechanisms for the activation of Toll-like receptor 2/4 by saturated fatty acids and inhibition by docosahexaenoic acid.

  2016cites this paper
• Drosophila immune responses in a model for epithelial hypertrophy

  2016cites this paper
• Toll Receptor-Mediated Hippo Signaling Controls Innate Immunity in Drosophila.

  2016cites this paper
• The Friend of GATA Transcriptional Co-Regulator, U-Shaped, Is a Downstream Antagonist of Dorsal-Driven Prohemocyte Differentiation in Drosophila

  2016cites this paper
• TGAAGATGGTCGAGGGGTAAGCCG GGCATCAGACCCATCACCCAGAA TACC TTGAAGCCGAAACACAGAGCCA ATCT TACTGTGTTCATTGTGTCATTGG ACGAGTCCGAGTTCAT AGGTTGACGAGGAACA TTGCGCCGTACTCAT GGTCTGTCCGTTCTT ACGGAATTCCCTCCT TGCAACGCATAGACC ACTCTCCTTACGATG CAGACAGGTCTCCAA CCACCTGACTGTACC TACTGACGAGGCAAT CTGGAGGAGGAAACT AGACACTTGGACTCG

  2016cites this paper
• Cytokines in Drosophila immunity.

  2016cites this paper
• Survival of the Fittest: Essential Roles of Cell Competition in Development, Aging, and Cancer.

  2016cites this paper
• Drosophila melanogaster clip-domain serine proteases: Structure, function and regulation.

  2016influential citation
• Ex vivo genome-wide RNAi screening of the Drosophila Toll signaling pathway elicited by a larva-derived tissue extract.

  2015cites this paper
• Controversial Role of Toll-like Receptor 4 in Adult Stem Cells

  2015cites this paper
• Analysis of Scaling Properties of Embryonic Morphogen Gradients During Drosophila Evolution

  2015cites this paper
• Immune-Related Gene Spatzle4 and Its Differential Immune Responses against Microbes in the Silkworm, Bombyx Mori

  2015cites this paper
• Toll pathway modulates TNF-induced JNK-dependent cell death in Drosophila

  2015cites this paper
• The Role of the Phylogenetically Conserved Cochaperone Protein Droj2/DNAJA3 in NF-κB Signaling*

  2015cites this paper
• Cathosis: Cathepsins in Particle-induced Inflammatory Cell Death: A Dissertation

  2015cites this paper
• Cecropins from Plutella xylostella and Their Interaction with Metarhizium anisopliae

  2015cites this paper
• Genome-wide RNAi screening implicates the E3 ubiquitin ligase Sherpa in mediating innate immune signaling by Toll in Drosophila adults

  2015cites this paper
• Signaling Cascades, Gradients, and Gene Networks in Dorsal/Ventral Patterning

  2015cites this paper
• Paralytic peptide: an insect cytokine that mediates innate immunity.

  2015cites this paper
• Mesendoderm Patterning by the Nodal/Lefty Activator/Inhibitor System

  2015cites this paper
• Structure of the Toll-Spätzle complex, a molecular hub in Drosophila development and innate immunity

  2014cites this paper
• DEV112797 1..11

  2014cites this paper
• Wnt/β-catenin signaling integrates patterning and metabolism of the insect growth zone

  2014cites this paper
• Retromer Promotes Immune Quiescence by Suppressing Spätzle‐Toll Pathway in Drosophila

  2014cites this paper
• Sequential axon-derived signals couple target survival and layer specificity in the Drosophila visual system.

  2014cites this paper
• Interferon Induction by RNA Viruses and Antagonism by Viral Pathogens

  2014cites this paper
• Ndae1 Expression and Regulation in Drosophila Embryos

  2014cites this paper
• Cytonemes and the dispersion of morphogens

  2014cites this paper
• The Toll/NF-κB signaling pathway is required for epidermal wound repair in Drosophila

  2014cites this paper