Yeasts and yeast-like organisms associated with fruits and blossoms of different fruit trees.

No abstract is available for this paper.

• Publication year

  2012

• Venue

  Canadian Journal of Microbiology (print)

• Publication date

  2012-11-21

• Fields of study

  Biology, Medicine, Environmental Science

• Identifiers
  DOI 10.1139/cjm-2012-0468PMID 23210991
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Extracellular enzymatic activities and physiological profiles of yeasts colonizing fruit trees

  2014cited by this paper
• Exploring the northern limit of the distribution of Saccharomyces cerevisiae and Saccharomyces paradoxus in North America.

  2014cited by this paper
• Biology and Sources of Inoculum of Geotrichum candidum Causing Sour Rot of Peach and Nectarine Fruit in California.

  2012cited by this paper
• Preliminary prospection of the yeast biodiversity on apple and pear surfaces from Northern Italy orchards

  2011cited by this paper
• Fermentation behavior of osmophilic yeast Candida tropicalis isolated from the nectar of Hibiscus rosa sinensis flowers for xylitol production

  2011cited by this paper
• Methods for isolation, phenotypic characterization and maintenance of yeasts

  2011cited by this paper
• Metschnikowia Kamienski (1899)

  2011cited by this paper
• The Yeasts, a Taxonomic Study, 5th ed

  2011cited by this paper
• Inhospitable sweetness: nectar filtering of pollinator-borne inocula leads to impoverished, phylogenetically clustered yeast communities

  2010cited by this paper
• Species Richness of Yeast Communities in Floral Nectar of Southern Spanish Plants

  2010cited by this paper
• Yeasts associated with nectarines and their potential for biological control of brown rot

  2010cited by this paper
• Endophytic yeast fungi in plant storage tissues

  2010cited by this paper
• Efficacy of the antagonist Aureobasidium pullulans PL5 against postharvest pathogens of peach, apple and plum and its modes of action

  2010cited by this paper
• Co-fermentation with "Pichia Kluyveri" increases varietal thiol concentrations in Sauvignon Blanc

  2009cited by this paper
• Epiphytic bacteria and yeasts on apple blossoms and their potential as antagonists of Erwinia amylovora.

  2009cited by this paper
• Yeasts colonizing the leaves of fruit trees

  2009cited by this paper
• Effect of Pichia membranaefaciens combined with salicylic acid on controlling brown rot in peach fruit and the mechanisms involved

  2008cited by this paper
• Reducing oxidative stress in sweet cherry fruit by Pichia membranaefaciens: a possible mode of action against Penicillium expansum

  2008cited by this paper
• Yeasts colonizing the leaf surfaces

  2007cited by this paper
• Seasonal dynamic of the numbers of epiphytic yeasts

  2007cited by this paper
• Diversity and evolution of non-Saccharomyces yeast populations during wine fermentation: effect of grape ripeness and cold maceration.

  2006cited by this paper
• Biodiversity and ecophysiology of yeasts

  2006cited by this paper
• Yeast Communities in Tropical Rain Forests in Brazil and other South American Ecosystems

  2006cited by this paper
• Yeasts isolated from three varieties of grapes cultivated in different locations of the Dolenjska vine-growing region, Slovenia.

  2006cited by this paper
• Metschnikowia Strains Isolated from Botrytized Grapes Antagonize Fungal and Bacterial Growth by Iron Depletion

  2006cited by this paper
• Can phyllosphere yeasts explain the effect of scab fungicides on russeting of Elstar apples?

  2004cited by this paper
• Ecology of yeasts in plant-bumblebee mutualism in Central Europe.

  2004cited by this paper
• Microbiological characteristics of the węgierka zwykła plum orchard in submontane region

  2003cited by this paper
• Microbiology of the Phyllosphere

  2003cited by this paper
• Yeasts associated with fresh and frozen pulps of Brazilian tropical fruits.

  2002cited by this paper
• Evaluation of microbiological quality of medicinal plants used in natural infusions.

  2001cited by this paper
• Biogeography of the yeasts of ephemeral flowers and their insects.

  2001cited by this paper
• Microbial population dynamics on Golden Delicious apples from bud to harvest and effect of fungicide applications

  1999cited by this paper
• Identification of yeasts by RFLP analysis of the 5.8S rRNA gene and the two ribosomal internal transcribed spacers.

  1999cited by this paper
• Rapid identification of wine yeast species based on RFLP analysis of the ribosomal internal transcribed spacer (ITS) region

  1998cited by this paper
• Russet of Apple Fruit Caused by Aureobasidium pullulans and Rhodotorula glutinis.

  1997cited by this paper
• Enumeration of bacterial and yeast colonists of apple fruits and identification of epiphytic yeasts on pear fruits in the Pacific Northwest United States.

  1996cited by this paper
• Composition of yeast population on the fruits of morello cherries (Cerasus vulgaris)

  1996cited by this paper
• Yeasts associated with flowers and fruits from a semi - arid region of northeastern brazil

  1996cited by this paper
• Yeasts associated with a pineapple plantation in rio de janeiro brazil

  1989cited by this paper
• Yeasts: Characteristics and Identification

  1983cited by this paper
• The yeasts : a taxonomic study

  1972cited by this paper

• Optimization of ethanol production from fermentation of cassava mill effluent

  2025cites this paper
• Phylogenetic Diversity and Extracellular Enzymatic Activities of Yeasts and Yeast-Like Fungi Isolated From Qualea grandiflora (Vochysiaceae) in Cerrado Areas in Northern Minas Gerais, Brazil

  2025cites this paper
• Unveiling the potential of native Blueberry-derived yeasts as biocontrol agents against Botrytis cinerea and Alternaria alternata

  2025cites this paper
• Attraction and aversion of noctuid moths to fermented food sources coordinated by olfactory receptors from distinct gene families

  2025cites this paper
• Diversity, Distribution, and Phenotypic Characterization of Cultivable Wild Yeasts Isolated from Natural Forest

  2025cites this paper
• Two new arthroconidial yeast species from bark and pit mud in China

  2025cites this paper
• Yeast volatiles show promise as a semiochemical lure for Carpophilustruncatus, an emerging pest of almond orchards around the world

  2025cites this paper
• Genetic and phenotypic diversity of wine-associated Hanseniaspora species

  2025cites this paper
• Pichia kudriavzevii UNJCC Y-137 and Candida tropicalis UNJCC Y-140 isolated from Durio kutejensis as potential probiotic agents

  2024cites this paper
• Richness of yeast community associated with apple fruits in Estonia

  2024cites this paper
• Ascomycetes yeasts: The hidden part of human microbiome.

  2024cites this paper
• Taxonomic revision of Geotrichum and Magnusiomyces, with the descriptions of five new Geotrichum species from China

  2024cites this paper
• Molecular Identification and Antifungal Activity of Candida chrysomelidarum and Rhodotorula toruloides Isolated from Indonesian Indigenous Fruit Flacourtia inermis Roxb. (Lobi-lobi) against Pathogenic Mold Aspergillus flavus

  2024cites this paper
• Patulin inhibition of specific apple microbiome members uncovers Hanseniaspora uvarum as a potential biocontrol agent.

  2024cites this paper
• Unlocking the oenological potential of native non-Saccharomyces yeasts from fruit microbiota

  2024cites this paper
• Influence of Pepper and Blueberry Purees Fermented by an Autochthonous Microbial Consortium on the Aroma and Technological Properties of Bread

  2024cites this paper
• Molecular characterization of non-Cryptococcus yeast communities isolated from Eucalyptus trees

  2024cites this paper
• D-Limonene Inhibits Pichia kluyveri Y-11519 in Sichuan Pickles by Disrupting Metabolism

  2024cites this paper
• Endophytic and epiphytic metabarcoding reveals fungal communities on cashew phyllosphere in Kenya

  2024cites this paper
• The marula and elephant intoxication myth: assessing the biodiversity of fermenting yeasts associated with marula fruits (Sclerocarya birrea)

  2023cites this paper
• Wild and partially synanthropic bird yeast diversity, in vitro virulence, and antifungal susceptibility of Candida parapsilosis and Candida tropicalis strains isolated from feces

  2023cites this paper
• Endophytic strains of the yeast Metschnikowia pulcherrima positive for phytohormones production

  2023cites this paper
• Occurrence and Diversity of Yeast Associated with Fruits and Leaves of Two Native Plants from Brazilian Neotropical Savanna

  2023cites this paper
• Presence of Saccharomyces eubayanus in fermentative environments reveals a new adaptive scenario in Patagonia

  2023cites this paper
• Seed dispersal syndrome predicts ethanol concentration of fruits in a tropical dry forest

  2023cites this paper
• Yeasts associated with mines on tree leaves in the urban areas

  2023cites this paper
• Exploring future applications of the apiculate yeast Hanseniaspora

  2023cites this paper
• Moniliella zaluziensis sp. nov., a black yeast related to fruit trees of the Rosaceae family.

  2023cites this paper
• Hydrolytic Enzyme Production and Susceptibility to Antifungal Compounds of Opportunistic Candida parapsilosis Strains Isolated from Cucurbitaceae and Rosaceae Fruits

  2023cites this paper
• A special drop: Characterising yeast isolates associated with fermented beverages produced by Australia's indigenous peoples.

  2023cites this paper
• Microbiomes Associated With the Surfaces of Northern Argentinian Fruits Show a Wide Species Diversity

  2022influential citation
• The Microbiome of the ‘Williams’ Pear Variety Grown in the Organic Orchard and Antifungal Activity by the Autochthonous Bacterial and Yeast Isolates

  2022cites this paper
• Mutualism between Gut-Borne Yeasts and Their Host, Thaumatotibia leucotreta, and Potential Usefulness in Pest Management

  2022cites this paper
• Morphological, physiological, and molecular identification and characterization of yeast isolated from Indonesian fruits and woods

  2022cites this paper
• The Human Mycobiome: Colonization, Composition and the Role in Health and Disease

  2022cites this paper
• Candida krusei is the major contaminant of ultrafiltration and reverse osmosis membranes used for cranberry juice production.

  2022cites this paper
• What Is Candida Doing in My Food? A Review and Safety Alert on Its Use as Starter Cultures in Fermented Foods

  2022cites this paper
• A catalogue of cultivable yeasts from the microbiota of grape berries cv. Vinhão and Loureiro

  2022influential citation
• Fruit Microbial Communities of the Bisucciu Sardinian Apricot Cultivar (Prunus armeniaca L.) as a Reservoir of New Brewing Starter Strains

  2022cites this paper
• Microbial communities of sweet cherry (Prunus avium L.) and assessment of their association with cherry slip-skin-maceration disorder

  2022influential citation
• Mycobiota in the Carposphere of Sour and Sweet Cherries and Antagonistic Features of Potential Biocontrol Yeasts

  2021cites this paper
• Yeast as plant growth promoter and biocontrol agent

  2021cites this paper
• Yeasts with Fermentative Potential Associated with Fruits of Camu-Camu (Myrciaria dubia, Kunth) from North of Brazilian Amazon

  2021cites this paper
• Compartmentalization of bacterial and fungal microbiomes in the gut of adult honeybees

  2021cites this paper
• Visualisation of the mode of action of a biological control agent, Aureobasidium pullulans (strain YBCA5) against Pseudomonas syringae pv. actinidiae biovar 3 on the kiwifruit phylloplane

  2021cites this paper
• Metagenomic-based Approach for the Analysis of Yeast Diversity Associated with Amylase Production in Lai (Durio kutejensis)

  2021cites this paper
• DNA metabarcoding of forensic mycological samples

  2021cites this paper
• Separate and combined Hanseniaspora uvarum and Metschnikowia pulcherrima metabolic volatiles are attractive to Drosophila suzukii in the laboratory and field

  2021cites this paper
• Bioethanolic yeasts from dung beetles: tapping the potential of extremophilic yeasts for improvement of lignocellulolytic feedstock fermentation

  2021cites this paper
• Behind the nectar: the yeast community in bromeliads inflorescences after the exudate removal

  2021influential citation
• Yeasts in native fruits from Brazilian neotropical savannah: occurrence, diversity and enzymatic potential

  2021cites this paper
• Mango Endophyte and Epiphyte Microbiome Composition during Fruit Development and Post-Harvest Stages

  2021cites this paper
• An Updated Global Species Diversity and Phylogeny in the Genus Wickerhamomyces with Addition of Two New Species from Thailand

  2021cites this paper
• Substrate, temperature, and geographical patterns among nearly 2,000 natural yeast isolates

  2021cites this paper
• Stability of Dry and Liquid Metschnikowia pulcherrima Formulations for Biocontrol Applications against Apple Postharvest Diseases

  2021cites this paper
• Behind the nectar: the yeast community in bromeliads inflorescences after the exudate removal

  2021cites this paper
• The Apple Microbiome: Structure, Function, and Manipulation for Improved Plant Health

  2021cites this paper
• fuPCR as diagnostic method for the detection of rare fungal pathogens, such as Trichosporon, Cryptococcus and Fusarium.

  2021cites this paper
• WHITE MULBERRY (MORUS ALBA L.) FRUIT-ASSOCIATED BACTERIAL AND FUNGAL MICROBIOTA

  2020cites this paper
• Changes of Quality of Minimally-Processed Pineapple (Ananas comosus, var. ‘Queen Victoria’) during Cold Storage: Fungi in the Leading Role

  2020cites this paper
• Standardization of Plant Microbiome Studies: Which Proportion of the Microbiota is Really Harvested?

  2020influential citation
• Yeasts Influence Host Selection and Larval Fitness in Two Frugivorous Carpophilus Beetle Species

  2020cites this paper
• Forest Oak Woodlands and Fruit Tree Soils Are Reservoirs of Wine-Related Yeast Species

  2020cites this paper
• Fungal Microbiota of Sea Buckthorn Berries at Two Ripening Stages and Volatile Profiling of Potential Biocontrol Yeasts

  2020cites this paper
• Metschnikowia pulcherrima and Related Pulcherrimin-Producing Yeasts: Fuzzy Species Boundaries and Complex Antimicrobial Antagonism

  2020cites this paper
• Yeasts Associated with Various Amazonian Native Fruits.

  2020cites this paper
• Gut microbial composition in different castes and developmental stages of the invasive hornet Vespa velutina nigrithorax.

  2020cites this paper
• Growth Dynamics and Diversity of Yeasts during Spontaneous Plum Mash Fermentation of Different Varieties

  2020cites this paper
• Tobacco Hornworm (Manduca sexta) caterpillars as a novel host model for the study of fungal virulence and drug efficacy

  2020cites this paper
• Unconventional Yeasts Are Tolerant to Common Antifungals, and Aureobasidium pullulans Has Low Baseline Sensitivity to Captan, Cyprodinil, and Difenoconazole

  2020cites this paper
• Potential probiotic and food protection role of wild yeasts isolated from pistachio fruits (Pistacia vera).

  2020cites this paper
• Innate pathogenic traits in oral yeasts

  2020cites this paper
• IDENTIFICATION AND CHARACTERIZATION OF YEAST ISOLATES FROM MAPRANG (Bouea macrophylla Griffith) GROWING IN VIETNAM

  2020cites this paper
• MATRIX-ASSISTED LASER DESORPTION IONIZATION-TIME OF FLIGHT MASS SPECTROMETRY BASED IDENTIFICATION OF THE FISH GUT MICROBIOTA

  2019cites this paper
• Hippophae rhamnoides berry related Pichia kudriavzevii yeast volatiles modify behaviour of Rhagoletis batava flies

  2019cites this paper
• The little caterpillar that could – Tobacco Hornworm (Manduca sexta) caterpillars as a novel host model for the study of fungal virulence and drug efficacy

  2019cites this paper
• Diversity of yeasts in the soil adjacent to fruit trees of the Rosaceae family

  2019cites this paper
• Snf2 controls pulcherriminic acid biosynthesis and antifungal activity of the biocontrol yeast Metschnikowia pulcherrima

  2019cites this paper
• Overview of craft brewing specificities and potentially associated microbiota

  2019cites this paper
• Biocontrol yeasts: mechanisms and applications

  2019cites this paper
• Microbial Diversity on Grapes and Other Fruits: Role and Significance in Fermentation

  2019cites this paper
• Characterization of antagonistic yeasts for biocontrol applications on apples or in soil by quantitative analyses of synthetic yeast communities

  2018cites this paper
• Genetic re-engineering of polyunsaturated phospholipid profile of Saccharomyces cerevisiae identifies a novel role for Cld1 in mitigating the effects of cardiolipin peroxidation.

  2018cites this paper
• High content analysis of sea buckthorn, black chokeberry, red and white currants microbiota - A pilot study.

  2018cites this paper
• Yeasts of the soil – obscure but precious

  2018cites this paper
• Molecular Identification and Distribution of Yeasts in Fruits

  2018cites this paper
• Natural fruits, flowers, honey, and honeybees harbor Helicobacter pylori‐positive yeasts

  2018cites this paper
• Diversity of floricolous yeasts and filamentous fungi of some ornamental and edible fruit plants in Assiut area, Egypt

  2018cites this paper
• Distribution of apple and blackcurrant microbiota in Lithuania and the Czech Republic.

  2018influential citation
• The ecology of insect–yeast relationships and its relevance to human industry

  2018cites this paper
• Near full-length 16S rRNA gene next-generation sequencing revealed Asaia as a common midgut bacterium of wild and domesticated Queensland fruit fly larvae

  2018cites this paper
• Snf2 controls pulcherriminic acid biosynthesis and connects pigmentation and antifungal activity of the yeast Metschnikowia pulcherrima

  2018cites this paper
• Flowers as a reservoir of yeast diversity: description of Wickerhamiella nectarea f.a. sp. nov., and Wickerhamiella natalensis f.a. sp. nov. from South African flowers and pollinators, and transfer of related Candida species to the genus Wickerhamiella as new combinations

  2017cites this paper
• Glycolytic Functions Are Conserved in the Genome of the Wine Yeast Hanseniaspora uvarum, and Pyruvate Kinase Limits Its Capacity for Alcoholic Fermentation

  2017cites this paper
• Endophytic yeasts in Malus domestica and Pyrus communis fruits under anthropogenic impact

  2017cites this paper
• TCTACCATAGCCAATCAAAG CCAGACTTAGAGCTGATGAC GCTTACAGCACCTAAAGATG GGCTCAAATTTAGCACCATC TTGACATGTTCGAGGTGTTC GATCCCTGCTTTACTTGAC 9 AACTAAGGCAGTATCCAAAG GGTTTAGCAGAATCTTTAGC TGCCTACCTTAAATTCTCAC GCAGCTGATCTATCACTTTG TGGAATAACGGAGTGAATAC GTCATGTTCTTCACCATACC 10 AAATGGCCGAAACCATTGGG CTTGTGTTGTTGCTGAATAC AT

  2017cites this paper
• Survey of conspecific herbivore-induced volatiles from apple as possible attractants for Pandemis pyrusana (Lepidoptera: Tortricidae).

  2017cites this paper
• Yeasts in Agricultural and Managed Soils

  2017cites this paper
• Adding yeasts with sugar to increase the number of effective insecticide classes to manage Drosophila suzukii (Matsumura) (Diptera: Drosophilidae) in cherry.

  2016cites this paper
• Fungal diversity of marine biofilms on artificial reefs in the north-central Gulf of Mexico

  2016cites this paper