Allele-specific replication timing of imprinted gene regions

No abstract is available for this paper.

• Publication year

  1993

• Venue

  Nature

• Publication date

  1993-07-29

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1038/364459A0PMID 8332218
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Replication asynchrony between homologs 15q11.2: Cytogenetic evidence for genomic imprinting

  2005cited by this paper
• Relaxation of imprinted genes in human cancer

  1993cited by this paper
• A gene for the mouse pink-eyed dilution locus and for human type II oculocutaneous albinism

  1993cited by this paper
• Relaxation of insulin-like growth factor II gene imprinting implicated in Wilms' tumour

  1993cited by this paper
• Evaluation of potential models for imprinted and nonimprinted components of human chromosome 15q11-q13 syndromes by fine-structure homology mapping in the mouse.

  1993cited by this paper
• Delineation of DNA replication time zones by fluorescence in situ hybridization.

  1992cited by this paper
• Parental origin of chromosomes involved in the translocation t(9;22)

  1992cited by this paper
• Physical linkage of two mammalian imprinted genes, H19 and insulin–like growth factor 2

  1992cited by this paper
• Maternal imprinting of the mouse Snrpn gene and conserved linkage homology with the human Prader–Willi syndrome region

  1992cited by this paper
• Parental imprinting of the human H19 gene

  1992cited by this paper
• Molecular dissection of the Prader-Willi/Angelman syndrome region (15q11-13) by YAC cloning and FISH analysis.

  1992cited by this paper
• Genetic analysis of genomic imprinting: an Imprintor-1 gene controls inactivation of the paternal copy of the mouse Tme locus.

  1992cited by this paper
• A DNA methylation imprint, determined by the sex of the parent, distinguishes the Angelman and Prader-Willi syndromes.

  1992cited by this paper
• Small nuclear ribonucleoprotein polypeptide N (SNRPN), an expressed gene in the Prader–Willi syndrome critical region

  1992cited by this paper
• Monoallelic expression of the human H19 gene

  1992cited by this paper
• Molecular diagnosis of the Prader-Willi and Angelman syndromes by detection of parent-of-origin specific DNA methylation in 15q11-13

  1992cited by this paper
• Molecular dissection of the Prader-Willi/Angelman syndrome region (15q11–13) by YAC cloning and FISH analysis

  1992cited by this paper
• Mouse chromosome 7.

  1992cited by this paper
• Parental imprinting of the mouse insulin-like growth factor II gene.

  1991cited by this paper
• Parental imprinting of the mouse H19 gene

  1991cited by this paper
• The mouse insulin-like growth factor type-2 receptor is imprinted and closely linked to the Tme locus

  1991cited by this paper
• Evolution of Insulin-Like Growth Factor II: Characterization of the Mouse IGF-II Gene and Identification of Two Pseudo-Exons

  1990cited by this paper
• A deletion of the human beta-globin locus activation region causes a major alteration in chromatin structure and replication across the entire beta-globin locus.

  1990cited by this paper
• A molecular genetic linkage map of mouse chromosome 7.

  1990cited by this paper
• Analysis of DNA replication during S-phase by means of dynamic chromosome banding at high resolution

  1990cited by this paper
• High-resolution mapping of human chromosome 11 by in situ hybridization with cosmid clones.

  1990cited by this paper
• Genomic imprinting and embryonal tumours

  1989cited by this paper
• Cancer genetics. Genomic imprinting and embryonal tumours.

  1989cited by this paper
• Gamma delta beta-thalassemia due to a de novo mutation deleting the 5' beta-globin gene activation-region hypersensitive sites.

  1989cited by this paper
• Differential imprinting and expression of maternal and paternal genomes.

  1988cited by this paper
• Role of replication time in the control of tissue-specific gene expression.

  1987cited by this paper
• Role of replication time in the control of tissue-specific gene expression.

  1987cited by this paper
• Isolation of the human insulin-like growth factor genes: insulin-like growth factor II and insulin genes are contiguous.

  1985cited by this paper
• Correlation between X-chromosome inactivation and cell differentiation in female preimplantation mouse embryos.

  1985cited by this paper
• Replication timing of genes and middle repetitive sequences.

  1984cited by this paper
• Three mutant insulins in man

  1983cited by this paper
• Detection of sickle cell beta S-globin allele by hybridization with synthetic oligonucleotides.

  1983cited by this paper
• Polymorphic variants in human chromosome 15.

  1981cited by this paper
• Hairpin-tail: a case of post-reductional gene action in the mouse egg.

  1974cited by this paper
• Fluorescence and Giemsa banding studies of the allocyclic X chromosome in embryonic and adult mouse cells.

  1973cited by this paper

• DNA methylation and lncRNA control asynchronous DNA replication at specific imprinted gene domains

  2026cites this paper
• Atlas of imprinted and allele-specific DNA methylation in the human body

  2024cites this paper
• Parent-of-origin-specific DNA replication timing is confined to large imprinted regions.

  2024cites this paper
• A spatial genome aligner for resolving chromatin architectures from multiplexed DNA FISH

  2023cites this paper
• A spatial genome aligner for multiplexed DNA-FISH

  2022cites this paper
• Asynchronous Replication Timing: A Mechanism for Monoallelic Choice During Development

  2021cites this paper
• DNA methylation is required to maintain both DNA replication timing precision and 3D genome organization integrity.

  2021cites this paper
• Positive and Negative Regulation of DNA Replication Initiation.

  2020cites this paper
• The delicate relationship between DNA replication timing and gene expression

  2020cites this paper
• DNA methylation is required to maintain DNA replication timing precision and 3D genome integrity

  2020cites this paper
• The physiological function of long-noncoding RNAs

  2020cites this paper
• Endothelial Heterogeneity: A Role for Epigenetic Pathways in Constitutive Gene Expression

  2019cites this paper
• Monogenic and polygenic inheritance become instruments for clonal selection

  2019cites this paper
• Control of DNA replication timing in the 3D genome

  2019cites this paper
• Genome-wide stability of the DNA replication program in single mammalian cells

  2017cites this paper
• Allele-specific control of replication timing and genome organization during development

  2017cites this paper
• Replication Domains: Genome Compartmentalization into Functional Replication Units.

  2017cites this paper
• Regulation of IgL Chain Recombination

  2016cites this paper
• Replication timing and transcriptional control: beyond cause and effect-part III.

  2016cites this paper
• Erasure and reestablishment of random allelic expression imbalance after epigenetic reprogramming

  2016cites this paper
• Maintenance of Epigenetic Information.

  2016cites this paper
• Aneuploidy and asynchronous replication in non-alcholic fatty liver disease and cryptogenic cirrhosis.

  2016cites this paper
• Random monoallelic expression of genes on autosomes: Parallels with X-chromosome inactivation.

  2016cites this paper
• Replication timing regulation in adults with chromosomal balance rearrangements.

  2015cites this paper
• Asynchronous Replication in Lymphocytes from Patients with Inflammatory Bowel Disease and Primary Sclerosing Cholangitis

  2015cites this paper
• EPIGENTSKA OSNOVA GENOMSKOG IMPRINTINGA: PRADER - WILLI I ANGELMAN

  2015cites this paper
• Intermediate DNA methylation is a conserved signature of genome regulation

  2015cites this paper
• ICR noncoding RNA expression controls imprinting and DNA replication at the Dlk1-Dio3 domain.

  2014cites this paper
• Epigenetic regulation of the Igf2/H19 gene cluster

  2014cites this paper
• Independent recruitment of Igh alleles in V(D)J recombination

  2014cites this paper
• Genomic imprinting in mammals.

  2014cites this paper
• Epigenetic Regulation of Monoallelic Rearrangement (Allelic Exclusion) of Antigen Receptor Genes

  2014cites this paper
• Random monoallelic expression: regulating gene expression one allele at a time.

  2014cites this paper
• Characteristics of random monoallelic gene expression during embryonic stem cell differentiation

  2014cites this paper
• Asynchronous Replication Patterns of Imprinted Genes in Triploid Cells

  2014cites this paper
• Developmental dynamics and disease potential of random monoallelic gene expression.

  2014cites this paper
• Epigenetics and phenotypic variability: some interesting insights from birds

  2013cites this paper
• Regulation of DNA replication timing

  2013cites this paper
• Alterations in replication timing of cancer‐related genes in malignant human breast cancer cells

  2013influential citation
• Genomic Imprinting and Uniparental Disomy

  2013cites this paper
• Random and Non-Random Monoallelic Expression

  2013cites this paper
• Epigenetic regulation of higher order chromatin conformations and networks

  2013cites this paper
• Condensin II initiates sister chromatid resolution during S phase

  2013cites this paper
• literat re report DNA replication : the unbearable lightness of origins

  2013cites this paper
• Nonmammalian parent-of-origin effects.

  2012cites this paper
• Selected imprinting of INS in the marsupial

  2012cites this paper
• Nonmammalian parent-of-origin effects.

  2012cites this paper
• Mechanisms and consequences of widespread random monoallelic expression

  2012cites this paper
• Epigenetic regulation of the Igf2/H19 gene cluster

  2012cites this paper
• Identifizierung und epigenetische Regulation von neuen geprägten Genen

  2012cites this paper
• Transcription Is Required to Establish Maternal Imprinting at the Prader-Willi Syndrome and Angelman Syndrome Locus

  2011cites this paper
• Imprinting and the Epigenetic Asymmetry between Parental Genomes

  2011cites this paper
• Molecular Genetics of Genomic Imprinting

  2011cites this paper
• Replication Timing: Evolution, Nuclear Organization and Relevance for Human Disease

  2011cites this paper
• Bubble-chip analysis of human origin distributions demonstrates on a genomic scale significant clustering into zones and significant association with transcription.

  2011cites this paper
• Replication timing aberrations and aneuploidy in peripheral blood lymphocytes of breast cancer patients.

  2010cites this paper
• Characterization of the murine Angelman syndrome imprinting center

  2010cites this paper
• Achieving singularity in mammalian odorant receptor gene choice.

  2010cites this paper
• Diagnosis of Cryptic Chromosomal Syndromes by Fluorescence In Situ Hybridization (FISH)

  2010cites this paper
• NETWORKS IN EPIGENETICS

  2010cites this paper
• DNA methylation at imprinted and non-imprinted genes in the sperm of men affected by severe male factor infertility

  2010cites this paper
• Prader-Willi-Syndrom und Angelman-Syndrom

  2010cites this paper
• Characterization of a novel fluorescent reporter of genomic imprinting in the mouse

  2010influential citation
• Low-copy repeats on chromosome 22q11.2 show replication timing switches, DNA flexibility peaks and stress inducible asynchrony, sharing instability features with fragile sites.

  2010cites this paper
• Expressionsanalysen geprägter Gene in der Prader-Willi-/Angelman-Syndrom-Region

  2010cites this paper
• Incomplete penetrance and variable expressivity: is there a microRNA connection?

  2009cites this paper
• Allelic inactivation of rDNA loci.

  2009cites this paper
• Monoallelic expression and tissue specificity are associated with high crossover rates.

  2009cites this paper
• Investigating the role of the imprinted Grb10 gene in the regulation of maternal nutrient transfer.

  2009cites this paper
• Microdeletion syndromes disclose replication timing alterations of genes unrelated to the missing DNA

  2009cites this paper
• Asynchronous replication dynamics of imprinted and non-imprinted chromosome regions in early mouse embryos.

  2008influential citation
• Global organization of replication time zones of the mouse genome.

  2008cites this paper
• Algorithmic analysis of human dna replication timing from discrete microarray data

  2008cites this paper
• A mechanistic view of genomic imprinting.

  2008cites this paper
• Aberrant allele-specific replication, independent of parental origin, in blood cells of cancer patients

  2008influential citation
• Extraction of Human DNA Replication Timing Patterns from Discrete Microarray Data

  2008cites this paper
• Nucleosome positioning in human HOX gene clusters.

  2008cites this paper
• CTCF Regulates Asynchronous Replication of the Imprinted H19/Igf2 Domain

  2007cites this paper
• Spotlight on Rett Syndrome : Review The Odyssey of MeCP 2 and Parental Imprinting

  2007cites this paper
• Replication profile of PCDH11X and PCDH11Y, a gene pair located in the non-pseudoautosomal homologous region Xq21.3/Yp11.2

  2007cites this paper
• 15 q 11-13 GABAA receptor genes are normally biallelically expressed in brain yet are subject to epigenetic dysregulation in autism-spectrum disorders

  2007cites this paper
• Parent-of-origin specific QTL – a possibility towards understanding reciprocal effects in chicken and the origin of imprinting

  2007cites this paper
• 15q11-13 GABAA receptor genes are normally biallelically expressed in brain yet are subject to epigenetic dysregulation in autism-spectrum disorders.

  2007cites this paper
• Quantitative Trait Loci and Single Nucleotide Polymorphism

  2007cites this paper
• Replication Timing Profile Reflects the Distinct Functional and Genomic Features of the MHC Class II Region

  2007cites this paper
• The Odyssey of MeCP2 and Parental Imprinting

  2007cites this paper
• The Odyssey of MeCP2 and parental imprinting.

  2007cites this paper
• Conserved synteny of mammalian imprinted genes in chicken, frog, and fish genomes

  2007cites this paper
• Primer Sequences AATTAACCGTTTTGGTCCT GCGACACACACTTCCC GCCAGTGATGCTAAAGGTTG AACATACGTGGCTCTATGCA AAAGAGAC CTGCTAACAC CCTATGTTGGAGATGTTTAT GTCACCCAAAAGTCATGAGG TGTACCCG CATGCTATACAA GATCGTGCCACTGTACC CGCGTGTCTAACCTCATGGC GGGTTGGTTGTAAATTAAAAC TGTCAAATACTTAAGCACAG CATGTTGCCAAACACAGACC ATCCTGGCAAGACAGTT

  2007cites this paper
• Isochores and replication time zones: a perfect match

  2007cites this paper
• The imprinted mouse Igf2r/Air cluster – a model maternal imprinting system

  2006cites this paper
• Molecular cytogenetic characteristics of Down syndrome newborns

  2006cites this paper
• Genomic Imprinting, Molecular Genetics of

  2006cites this paper
• Somatische Mosaike und atypische Deletionen bei Patienten mit Prader-Willi- und Angelman-Syndrom

  2006cites this paper
• Profiling of DNA replication timing in unsynchronized cell populations

  2006cites this paper
• The influence of different chromosomal aberrations on molecular cytogenetic parameters in chronic lymphocytic leukemia.

  2006cites this paper
• Mapping of DNA Replication Origins to Noncoding Genes of the X-Inactivation Center

  2006cites this paper
• THE GENOME : Joining , Resolving , and Separating Sister Chromatids During Mitosis and Meiosis

  2006cites this paper
• Allelic silencing at the tumor-suppressor locus 13q14.3 suggests an epigenetic tumor-suppressor mechanism

  2006cites this paper
• Fluorescence In Situ Hybridization (FISH) Techniques

  2006cites this paper