The role of B lymphocytes in the progression from autoimmunity to autoimmune disease.

No abstract is available for this paper.

• Publication year

  2013

• Venue

  Clinical Immunology

• Publication date

  Unknown publication date

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1016/j.clim.2012.10.005PMID 23202542
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Altered B Cell Homeostasis Is Associated with Type I Diabetes and Carriers of the PTPN22 Allelic Variant

  2012cited by this paper
• B Lymphocytes Treated In Vitro with Antigen Coupled to Cholera Toxin B Subunit Induce Antigen-Specific Foxp3+ Regulatory T Cells and Protect against Experimental Autoimmune Encephalomyelitis

  2012cited by this paper
• A stepwise breakdown of B-cell tolerance occurs within renal allografts during chronic rejection.

  2012cited by this paper
• B Cell Repopulation After Alemtuzumab Induction—Transient Increase in Transitional B Cells and Long-Term Dominance of Naïve B Cells

  2012cited by this paper
• Gene expression signature in transplantation tolerance.

  2012cited by this paper
• Lipid-Antigen Presentation by CD1d+ B Cells Is Essential for the Maintenance of Invariant Natural Killer T Cells

  2012cited by this paper
• Humoral immunity in chronic allograft rejection: puzzle pieces come together.

  2012cited by this paper
• Inflamed target tissue provides a specific niche for highly expanded T-cell clones in early human autoimmune disease

  2012cited by this paper
• Antibodies of IgG, IgA and IgM isotypes against cyclic citrullinated peptide precede the development of rheumatoid arthritis

  2011cited by this paper
• Acquisition of Humoral Transplantation Tolerance upon De Novo Emergence of B Lymphocytes

  2011cited by this paper
• B Cells as a Therapeutic Target for IFN-β in Relapsing–Remitting Multiple Sclerosis

  2011cited by this paper
• IL-10-producing regulatory B10 cells inhibit intestinal injury in a mouse model.

  2011cited by this paper
• Immunoglobulin A: a bridge between innate and adaptive immunity

  2011cited by this paper
• Characterization of a rare IL-10-competent B-cell subset in humans that parallels mouse regulatory B10 cells.

  2011cited by this paper
• Long‐Term Allograft Tolerance Is Characterized by the Accumulation of B Cells Exhibiting an Inhibited Profile

  2011cited by this paper
• The PTPN22 allele encoding an R620W variant interferes with the removal of developing autoreactive B cells in humans.

  2011cited by this paper
• Autoimmunity and hepatitis A vaccine in children.

  2011cited by this paper
• Reduction in IL-10 producing B cells (Breg) in multiple sclerosis is accompanied by a reduced naïve/memory Breg ratio during a relapse but not in remission.

  2011cited by this paper
• Self-antigen presentation by mouse B cells results in regulatory T-cell induction rather than anergy or clonal deletion.

  2011cited by this paper
• Development of a cross-platform biomarker signature to detect renal transplant tolerance in humans.

  2010cited by this paper
• CD19(+)CD24(hi)CD38(hi) B cells exhibit regulatory capacity in healthy individuals but are functionally impaired in systemic Lupus Erythematosus patients.

  2010cited by this paper
• Patients with drug-free long-term graft function display increased numbers of peripheral B cells with a memory and inhibitory phenotype.

  2010cited by this paper
• Unique properties of memory B cells of different isotypes

  2010cited by this paper
• Somatic hypermutation as a generator of antinuclear antibodies in a murine model of systemic autoimmunity

  2010cited by this paper
• The extent of the anti-citrullinated protein antibody repertoire is associated with arthritis development in patients with seropositive arthralgia

  2010cited by this paper
• The ACPA isotype profile reflects long-term radiographic progression in rheumatoid arthritis

  2010cited by this paper
• Regulatory B cells prevent and reverse allergic airway inflammation via FoxP3-positive T regulatory cells in a murine model.

  2010cited by this paper
• Regulatory B cells in autoimmunity: developments and controversies

  2010cited by this paper
• IL‐10 produced by activated human B cells regulates CD4+ T‐cell activation in vitro

  2010cited by this paper
• Evidence for a functional role of IgE anticitrullinated protein antibodies in rheumatoid arthritis

  2010cited by this paper
• Epitope spreading of the anti-citrullinated protein antibody response occurs before disease onset and is associated with the disease course of early arthritis

  2010cited by this paper
• Identification of a B cell signature associated with renal transplant tolerance in humans.

  2010cited by this paper
• Intranasal administration of recombinant human cartilage glycoprotein-39 as a treatment for rheumatoid arthritis: a phase II, multicentre, double-blind, randomised, placebo-controlled, parallel-group, dose-finding trial

  2009cited by this paper
• Different properties of ACPA and IgM-RF derived from a large dataset: further evidence of two distinct autoantibody systems

  2009cited by this paper
• Reduced Fas ligand-expressing splenic CD5+ B lymphocytes in severe collagen-induced arthritis

  2009cited by this paper
• Signalling crosstalk in B cells: managing worth and need

  2009cited by this paper
• Alterations of the synovial T cell repertoire in anti-citrullinated protein antibody-positive rheumatoid arthritis.

  2009cited by this paper
• B-cell tolerance in transplantation: is repertoire remodeling the answer?

  2009cited by this paper
• The Development and Function of Regulatory B Cells Expressing IL-10 (B10 Cells) Requires Antigen Receptor Diversity and TLR Signals1

  2009cited by this paper
• Pretransplant detection of anti-endothelial cell antibodies could predict renal allograft outcome.

  2009cited by this paper
• Antibodies to MHC Class I Induce Autoimmunity: Role in the Pathogenesis of Chronic Rejection1

  2009cited by this paper
• Selective Targeting of B Cells with Agonistic Anti-CD40 Is an Efficacious Strategy for the Generation of Induced Regulatory T2-Like B Cells and for the Suppression of Lupus in MRL/lpr Mice1

  2009cited by this paper
• Increased percentages of autoantibodies in immunoglobulin A-deficient children do not correlate with clinical manifestations

  2009cited by this paper
• Antibody‐Mediated Microcirculation Injury Is the Major Cause of Late Kidney Transplant Failure

  2009cited by this paper
• Early and Limited Use of Tacrolimus to Avoid Rejection in an Alemtuzumab and Sirolimus Regimen for Kidney Transplantation: Clinical Results and Immune Monitoring

  2009cited by this paper
• Donor-Specific Antibodies Against HLA, MICA, and GSTT1 in Patients with Allograft Rejection and C4d Deposition in Renal Biopsies

  2009cited by this paper
• Helminth infections associated with multiple sclerosis induce regulatory B cells

  2008cited by this paper
• New developments in mast cell biology

  2008cited by this paper
• Incidence and Prediction of Early Antibody-Mediated Rejection due to Non-Human Leukocyte Antigen-Antibodies

  2008cited by this paper
• Prevalence and significance of isotypes of anti-cyclic citrullinated peptide antibodies in juvenile idiopathic arthritis

  2008cited by this paper
• Transplant Glomerulopathy: Risk and Prognosis Related to Anti-Human Leukocyte Antigen Class II Antibody Levels

  2008cited by this paper
• Regulatory Role of B Cells in a Murine Model of Allergic Airway Disease1

  2008cited by this paper
• A regulatory B cell subset with a unique CD1dhiCD5+ phenotype controls T cell-dependent inflammatory responses.

  2008cited by this paper
• Autoimmune response following annual influenza vaccination in 92 apparently healthy adults.

  2008cited by this paper
• Autoreactive IgG memory antibodies in patients with systemic lupus erythematosus arise from nonreactive and polyreactive precursors

  2008cited by this paper
• Anti-Type V Collagen Humoral Immunity in Lung Transplant Primary Graft Dysfunction1

  2008cited by this paper
• Regulatory B cells inhibit EAE initiation in mice while other B cells promote disease progression.

  2008cited by this paper
• Presence and utility of IgA-class antibodies to cyclic citrullinated peptides in early rheumatoid arthritis: the Swedish TIRA project

  2008cited by this paper
• Identification of a peripheral blood transcriptional biomarker panel associated with operational renal allograft tolerance

  2007cited by this paper
• Cutting Edge: Primary B Lymphocytes Preferentially Expand Allogeneic FoxP3+ CD4 T Cells

  2007cited by this paper
• Intravenous Transfusion of BCR-Activated B Cells Protects NOD Mice from Type 1 Diabetes in an IL-10-Dependent Manner1

  2007cited by this paper
• Naive B cells generate regulatory T cells in the presence of a mature immunologic synapse.

  2007cited by this paper
• The Relationship of Anti‐MICA Antibodies and MICA Expression with Heart Allograft Rejection

  2007cited by this paper
• IL-17-dependent cellular immunity to collagen type V predisposes to obliterative bronchiolitis in human lung transplants.

  2007cited by this paper
• Apoptotic cells protect mice from autoimmune inflammation by the induction of regulatory B cells

  2007cited by this paper
• Novel Suppressive Function of Transitional 2 B Cells in Experimental Arthritis1

  2007cited by this paper
• Lupus Susceptibility Genes May Breach Tolerance to DNA by Impairing Receptor Editing of Nuclear Antigen-Reactive B Cells1

  2007cited by this paper
• Four‐year Follow‐up of a Prospective Trial of HLA and MICA Antibodies on Kidney Graft Survival

  2007cited by this paper
• B Cell Regulation of CD4+CD25+ T Regulatory Cells and IL-10 Via B7 is Essential for Recovery From Experimental Autoimmune Encephalomyelitis1

  2007cited by this paper
• Autoantibodies to vimentin cause accelerated rejection of cardiac allografts.

  2007cited by this paper
• Direct and Indirect Effects of Alloantibodies Link Neointimal and Medial Remodeling in Graft Arteriosclerosis

  2006cited by this paper
• Myelin oligodendrocyte glycoprotein-specific T and B cells cooperate to induce a Devic-like disease in mice.

  2006cited by this paper
• Expression of MHC Class I–Related Chain B (MICB) Molecules on Renal Transplant Biopsies

  2006cited by this paper
• Clinical Operational Tolerance after Kidney Transplantation

  2006cited by this paper
• Spontaneous opticospinal encephalomyelitis in a double-transgenic mouse model of autoimmune T cell/B cell cooperation.

  2006cited by this paper
• High IgA rheumatoid factor levels are associated with poor clinical response to tumour necrosis factor α inhibitors in rheumatoid arthritis

  2006cited by this paper
• Contrasting CD25hiCD4+T Cells/FOXP3 Patterns in Chronic Rejection and Operational Drug-Free Tolerance

  2006cited by this paper
• Isotype distribution of anti-cyclic citrullinated peptide antibodies in undifferentiated arthritis and rheumatoid arthritis reflects an ongoing immune response.

  2006cited by this paper
• Antigen mimicry, epitope spreading and the pathogenesis of pemphigus.

  2006cited by this paper
• Infliximab, but not etanercept, induces IgM anti-double-stranded DNA autoantibodies as main antinuclear reactivity: biologic and clinical implications in autoimmune arthritis.

  2005cited by this paper
• Antigen-Specific B Cells Are Required as APCs and Autoantibody-Producing Cells for Induction of Severe Autoimmune Arthritis1

  2005cited by this paper
• Non-HLA transplantation immunity revealed by lymphocytotoxic antibodies.

  2005cited by this paper
• Angiotensin II type 1-receptor activating antibodies in renal-allograft rejection.

  2005cited by this paper
• Defective B cell tolerance checkpoints in systemic lupus erythematosus

  2005influential reference
• Lymphoid Neogenesis in Murine Cardiac Allografts Undergoing Chronic Rejection

  2005cited by this paper
• Role of CXCR3 in cellular but not humoral renal allograft rejection

  2005cited by this paper
• Divergent Immunoglobulin G Subclass Activity Through Selective Fc Receptor Binding

  2005cited by this paper
• The evolution of human anti-double-stranded DNA autoantibodies.

  2005cited by this paper
• Anti‐phospholipid antibodies following vaccination with recombinant hepatitis B vaccine

  2005cited by this paper
• Humoral theory of transplantation: further evidence.

  2005cited by this paper
• Deficiency of regulatory B cells increases allergic airway inflammation

  2005cited by this paper
• Antibody Response Against the Glomerular Basement Membrane Protein Agrin in Patients with Transplant Glomerulopathy

  2005cited by this paper
• Serial Ten‐Year Follow‐Up of HLA and MICA Antibody Production Prior to Kidney Graft Failure

  2005cited by this paper
• TLR-9 Activation of Marginal Zone B Cells in Lupus Mice Regulates Immunity Through Increased IL-10 Production

  2005cited by this paper
• Investigation of the role of B-cells in type 1 diabetes in the NOD mouse.

  2004cited by this paper
• Prognostic laboratory markers of joint damage in rheumatoid arthritis

  2004cited by this paper
• DETECTION OF VIMENTIN-SPECIFIC AUTOREACTIVE CD8+ T CELLS IN CARDIAC TRANSPLANT PATIENTS

  2004cited by this paper
• Donor-specific B-cell tolerance after ABO-incompatible infant heart transplantation

  2004cited by this paper
• Specific autoantibodies precede the symptoms of rheumatoid arthritis: a study of serial measurements in blood donors.

  2004cited by this paper
• Prevention of Arthritis by Interleukin 10–producing B Cells

  2003cited by this paper

• Immunotherapies in autoimmune neuromuscular junction disorders: Acute and chronic management.

  2026cites this paper
• Clonal analysis of SepSecS-specific B and T cells in autoimmune hepatitis

  2025cites this paper
• Systemic auto-inflammatory diseases, auto-immune diseases and immune deficiencies: From independent to overlapped diseases approach.

  2025cites this paper
• The casual relationship between autoimmune diseases and multiple myeloma: a Mendelian randomization study

  2024cites this paper
• The Application of Nanovaccines in Autoimmune Diseases

  2024cites this paper
• Autoimmunity in people with cystic fibrosis.

  2023cites this paper
• Role of genetics in eleven of the most common autoimmune diseases in the post genome-wide association studies era.

  2023cites this paper
• The knowns and unknowns of cardiac autoimmunity in viral myocarditis

  2023cites this paper
• Modern concept of autoimmunity in rheumatology

  2023cites this paper
• The link between immune thrombocytopenia and the cytokine profile: a bridge to new therapeutical targets

  2023cites this paper
• The emerging role of noncoding RNAs in systemic lupus erythematosus: new insights into the master regulators of disease pathogenesis

  2023cites this paper
• Advancing Biologic Therapy for Refractory Autoimmune Hepatitis

  2022cites this paper
• Origins and history of autoimmunity—A brief review

  2022cites this paper
• Membranous nephropathy: new pathogenic mechanisms and their clinical implications

  2022cites this paper
• Effect of Nicotine on Immune System Function

  2022cites this paper
• Dual Effect of Immune Cells within Tumour Microenvironment: Pro- and Anti-Tumour Effects and Their Triggers

  2022cites this paper
• Chronic Refractory Immune Thrombocytopenia Is Associated With Variants in Immune Genes

  2021cites this paper
• Btk Supports Autoreactive B Cell Development and Protects against Apoptosis but Is Expendable for Antigen Presentation

  2021cites this paper
• Review article: targeting the B cell activation system in autoimmune hepatitis

  2021cites this paper
• Immunomodulatory potential of flavonoids for the treatment of autoimmune diseases and tumour

  2021cites this paper
• The Potential Role of Regulatory B Cells in Idiopathic Membranous Nephropathy

  2020cites this paper
• Basophils and Systemic Lupus Erythematosus in Murine Models and Human Patients

  2020cites this paper
• Immunotherapy for Autoimmune Diseases

  2020cites this paper
• Reversing Autoimmunity Combination of Rituximab and Intravenous Immunoglobulin

  2018influential citation
• Losartan suppresses the inflammatory response in collagen-induced arthritis by inhibiting the MAPK and NF-κB pathways in B and T cells

  2018cites this paper
• Targeting Acquired Hemophilia A with Rheumatoid Arthritis by a Rituximab Shot: A Case Report and Review of the Literature

  2018cites this paper
• Interleukin-33 Contributes Toward Loss of Tolerance by Promoting B-Cell-Activating Factor of the Tumor-Necrosis-Factor Family (BAFF)-Dependent Autoantibody Production

  2018influential citation
• The Immunologic Paradoxes of IgG4-Related Disease

  2018cites this paper
• The Relationship between Hematological Indices and Autoimmune Rheumatic Diseases (ARDs), a Meta-Analysis

  2017cites this paper
• Anti-phospholipid syndrome: Current opinion on mechanisms involved, laboratory characterization and diagnostic aspects.

  2017cites this paper
• Advances in the pathophysiology of primary immune thrombocytopenia

  2017cites this paper
• Alterations in cytokine gene expression profile in colon mucosa of Inflammatory Bowel Disease patients on different therapeutic regimens

  2017cites this paper
• CP-25, a Novel Anti-inflammatory and Immunomodulatory Drug, Inhibits the Functions of Activated Human B Cells through Regulating BAFF and TNF-alpha Signaling and Comparative Efficacy with Biological Agents

  2017cites this paper
• Myeloid p38 MAPK signaling in intestinal homeostasis, inflammation and tumorigenesis = Señalización por la MAPK p38 de células mieloides en la homeostasis, inflamación y tumorogénesis intestinal

  2017cites this paper
• Autoimmunity and Inflammation

  2017cites this paper
• Autoantibodies to post‐translationally modified type I and II collagen in Charcot neuroarthropathy in subjects with type 2 diabetes mellitus

  2017cites this paper
• The role of antibodies in acquired thrombotic thrombocytopenic purpura

  2016influential citation
• Interaction between Mesenchymal Stem Cells and B-Cells

  2016cites this paper
• Regulatory B10 cells play a protective role in severe acute pancreatitis

  2016cites this paper
• mTOR Inhibition Attenuates Dextran Sulfate Sodium-Induced Colitis by Suppressing T Cell Proliferation and Balancing TH1/TH17/Treg Profile

  2016cites this paper
• Correction: mTOR Inhibition Attenuates Dextran Sulfate Sodium-Induced Colitis by Suppressing T Cell Proliferation and Balancing TH1/TH17/Treg Profile

  2016cites this paper
• The Centenary of Immune Thrombocytopenia – Part 1: Revising Nomenclature and Pathogenesis

  2016cites this paper
• Human autoimmune diseases: a comprehensive update

  2015cites this paper
• Oral Infections and Autoimmune Diseases

  2015cites this paper
• Epitope Spreading in Autoimmune Diseases

  2015cites this paper
• Implication des cellules NK au cours des maladies auto-immunes

  2014cites this paper
• Charge deficient analogues of the natural polyamines.

  2014cites this paper
• Engaging adaptive immunity with biomaterials.

  2014cites this paper
• Aberrant Frequency of IL-10-Producing B Cells and Its Association with Treg/Th17 in Adult Primary Immune Thrombocytopenia Patients

  2014cites this paper
• Immunological monitoring of the B-cell compartment in renal transplant recipients

  2014cites this paper
• Annexin A11 in disease.

  2014cites this paper
• Etiopathology of autoimmune disease and dental perspectives

  2014cites this paper
• Autoimmunity in the Pathogenesis and Treatment of Keratoconjunctivitis Sicca

  2014cites this paper
• HHV-6 and Multiple Sclerosis

  2014cites this paper
• B Cell Central Tolerance: Controlling Self-Reactive B Cells in the Bone Marrow

  2014cites this paper
• Cloning of recombinant monoclonal antibodies from hybridomas in a single mammalian expression plasmid.

  2014cites this paper
• Regulatory B cells: the new "it" cell.

  2014cites this paper
• Mesenchymal stromal cells infusions improve refractory chronic graft versus host disease through an increase of CD5+ regulatory B cells producing interleukin 10

  2014cites this paper
• A Review of Bacteria-Animal Lateral Gene Transfer May Inform Our Understanding of Diseases like Cancer

  2013cites this paper
• Chemoattraction: Basic Concepts and Role in the Immune Response

  2013cites this paper
• Aberrant histone modification in peripheral blood B cells from patients with systemic sclerosis.

  2013cites this paper
• GGATAGCACAGCCTGGATAGCAAC TGCGGCAGCATTCTAAGGTT TGCGGATTCTATGAGGCTTCA GATTCAGCAGCTCCACT GATTCAGCAGCTCCACT CAG GAA TAG AGG ATGTGC TCCAGTCACTAGAGCTTG CTCCAGGGTTCTGTAGG CACTGTCCACAAACCTTGCT GAAGTGGCATTCTGTTG CTCCTTCATAATCCTTGATA GGAAGTGCTTGAGGATACGCAC GCAAAGCGAATACTGTGTGCC GGAGACCAAGAATACATTA TTGGCCAI ..

  2013cites this paper
• Chemoattraction: Basic Concepts and Role in the Immune Response

  2013cites this paper
• Killer B Cells: Regulation of the Growth and Function of Fas Ligand-Expressing B Lymphocytes.

  2013cites this paper
• Targeting T and B Lymphocytes in Inflammatory Bowel Diseases: Lessons from Clinical Trials

  2013cites this paper
• Preliminary analysis of mortality associated with rituximab use in autoimmune diseases

  2013cites this paper
• Long-term Ro60 humoral autoimmunity in primary Sjögren's syndrome is maintained by rapid clonal turnover.

  2013cites this paper
• Retinoic acid‐producing, ex‐vivo‐generated human tolerogenic dendritic cells induce the proliferation of immunosuppressive B lymphocytes

  2013cites this paper
• Epitopes of Microbial and Human Heat Shock Protein 60 and Their Recognition in Myalgic Encephalomyelitis

  2013cites this paper
• Reply: To PMID 22736048.

  2013cites this paper
• Self-Tolerance in a Minimal Model of the Idiotypic Network

  2013cites this paper