A comprehensive search for DNA amplification in lung cancer identifies inhibitors of apoptosis cIAP1 and cIAP2 as candidate oncogenes.

No abstract is available for this paper.

• Publication year

  2003

• Venue

  Human Molecular Genetics

• Publication date

  2003-04-01

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1093/HMG/DDG083PMID 12651874
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Dipeptidyl peptidase IV, prolyl endopeptidase and cathepsin B activities in primary human lung tumours and lung parenchyma

  2005cited by this paper
• Comparative genomic hybridization analysis detected frequent overrepresentation of chromosome 3q in squamous cell carcinoma of the lung.

  2002influential reference
• Inhibitor of apoptosis protein-1 promotes tumor cell survival in mesothelioma.

  2002cited by this paper
• Genome wide detection of oncogene amplifications in nasopharyngeal carcinoma by array based comparative genomic hybridization.

  2002cited by this paper
• Expression of cIAP1, a target for 11q22 amplification, correlates with resistance of cervical cancers to radiotherapy.

  2002cited by this paper
• Targets of gene amplification and overexpression at 17q in gastric cancer.

  2002cited by this paper
• Comprehensive cytogenetic and molecular genetic characterization of the TI-1 acute myeloid leukemia cell line reveals cross-contamination with K-562 cell line.

  2002cited by this paper
• An AscI boundary library for the studies of genetic and epigenetic alterations in CpG islands.

  2002cited by this paper
• Inactivation of the apoptosis effector Apaf-1 in malignant melanoma

  2001cited by this paper
• Herceptest: Her2 expression and gene amplification in non‐small cell lung cancer

  2001cited by this paper
• Molecular cytogenetic characterization of head and neck squamous cell carcinoma and refinement of 3q amplification.

  2001cited by this paper
• Genomic imbalances in human lung adenocarcinomas and squamous cell carcinomas

  2001cited by this paper
• Amplification of 3q26 approximately qter correlates with tumor progression in head and neck squamous cell carcinomas.

  2001cited by this paper
• Isolation of a novel candidate oncogene within a frequently amplified region at 3q26 in ovarian cancer.

  2001cited by this paper
• Bves: prototype of a new class of cell adhesion molecules expressed during coronary artery development.

  2001cited by this paper
• HER2: the neu prognostic marker for breast cancer.

  2001cited by this paper
• Global methylation profiling of lung cancer identifies novel methylated genes.

  2001cited by this paper
• HER2: The Neu Prognostic Marker for Breast Cancer

  2001cited by this paper
• HER2/neu as a predictive factor in breast cancer.

  2001cited by this paper
• Identification of cIAP1 as a candidate target gene within an amplicon at 11q22 in esophageal squamous cell carcinomas.

  2001influential reference
• Amplification of 3q26∼qter correlates with tumor progression in head and neck squamous cell carcinomas

  2001cited by this paper
• Molecular cytogenetic analysis of non-small cell lung carcinoma by spectral karyotyping and comparative genomic hybridization.

  2001influential reference
• Novel amplification unit at chromosome 3q25–q27 in human prostate cancer

  2000cited by this paper
• At least five regions of imbalance on 6q in breast tumors, combining losses and gains

  2000cited by this paper
• Restriction landmark genomic scanning of mouse liver tumors for gene amplification: overexpression of cyclin A2.

  2000cited by this paper
• Aberrant CpG-island methylation has non-random and tumour-type–specific patterns

  2000cited by this paper
• Gene amplification in PNETs/medulloblastomas: mapping of a novel amplified gene within the MYCN amplicon

  2000cited by this paper
• AIS is an oncogene amplified in squamous cell carcinoma.

  2000cited by this paper
• PIK3CA as an oncogene in cervical cancer

  2000cited by this paper
• A broad amplification pattern at 3q in squamous cell lung cancer--a fluorescence in situ hybridization study.

  2000cited by this paper
• Detection of genetic alterations in the human gastric cancer cell lines by two-dimensional analysis of genomic DNA.

  2000cited by this paper
• DETECTION OF GENETIC ALTERATIONS IN MOUSE LUNG ADENOCARCINOMAS BY TWO-DIMENSIONAL GEL ELECTROPHORESIS

  2000cited by this paper
• Amplification and overexpression of the cyclin D1 and epidermal growth factor receptor genes in non-small-cell lung cancer

  1999cited by this paper
• A new tool for the rapid cloning of amplified and hypermethylated human DNA sequences from restriction landmark genome scanning gels.

  1999influential reference
• IAP family proteins--suppressors of apoptosis.

  1999cited by this paper
• Oncogene amplification in solid tumors.

  1999cited by this paper
• Expression analysis of genes at 3q26-q27 involved in frequent amplification in squamous cell lung carcinoma.

  1999cited by this paper
• GAC1, a new member of the leucine-rich repeat superfamily on chromosome band 1q32.1, is amplified and overexpressed in malignant gliomas

  1998cited by this paper
• Detection of 6q deletions in breast carcinoma cell lines by fluorescence in situ hybridization

  1998cited by this paper
• Detection of DNA amplification in human renal cell carcinoma cell lines using restriction landmark genomic scanning.

  1998cited by this paper
• Primary Carcinoma of the Fallopian Tube: Comparative Genomic Hybridization Reveals High Genetic Instability and a Specific, Recurring Pattern of Chromosomal Aberrations

  1998cited by this paper
• DNA gains in 3q occur frequently in squamous cell carcinoma of the lung, but not in adenocarcinoma

  1998cited by this paper
• IAPs block apoptotic events induced by caspase‐8 and cytochrome c by direct inhibition of distinct caspases

  1998cited by this paper
• Genomic amplification of a decoy receptor for Fas ligand in lung and colon cancer

  1998cited by this paper
• Comparative genomic hybridization detects frequent overrepresentation of chromosomal material from 3q26, 8q24, and 20q13 in human ovarian carcinomas

  1997cited by this paper
• Comparative genomic hybridization analysis detects frequent, often high-level, overrepresentation of DNA sequences at 3q, 5p, 7p, and 8q in human non-small cell lung carcinomas.

  1997cited by this paper
• Amplification of the genes BCHE and SLC2A2 in 40% of squamous cell carcinoma of the lung.

  1997cited by this paper
• Translation initiation factor eIF-4gamma is encoded by an amplified gene and induces an immune response in squamous cell lung carcinoma.

  1997cited by this paper
• MDM2 gene amplification and expression in non-small-cell lung cancer: immunohistochemical expression of its protein is a favourable prognostic marker in patients without p53 protein accumulation.

  1997cited by this paper
• Analyses of human gliomas by restriction landmark genomic scanning

  1997cited by this paper
• Cyclin-dependent kinase 6 (CDK6) amplification in human gliomas identified using two-dimensional separation of genomic DNA.

  1997cited by this paper
• Demethylation of repetitive DNA sequences in neuroblastoma

  1996cited by this paper
• Suppression of apoptosis in mammalian cells by NAIP and a related family of IAP genes

  1996cited by this paper
• Gains and losses of DNA sequences in osteosarcomas by comparative genomic hybridization.

  1995cited by this paper
• Biology of lung cancer.

  1994cited by this paper
• Amplification of N-myc as a prognostic marker for patients with neuroblastoma.

  1993cited by this paper
• The biology of lung cancer.

  1993cited by this paper
• New approach for detection of amplification in cancer DNA using restriction landmark genomic scanning.

  1992cited by this paper
• myc family DNA amplification in 107 tumors and tumor cell lines from patients with small cell lung cancer treated with different combination chemotherapy regimens.

  1991influential reference
• Cellular protoonocogenes are infrequently amplified in untreated non-small cell lung cancer.

  1989cited by this paper
• myc family oncogene amplification in tumor cell lines established from small cell lung cancer patients and its relationship to clinical status and course.

  1987influential reference
• Amplification and expression of the c-myc oncogene in human lung cancer cell lines

  1983influential reference
• Cellular protoonocogenes are infrequently amplified in untreated non-small cell lung cancer

  year unknowncited by this paper

• DCN-type NEDD8 E3 ligases: Structure, biological function and small-molecule inhibitor.

  2026cites this paper
• Expression of Forkhead Box M1 (FOXM1) and anticancer effects of FOXM1 inhibition in epithelial sarcoma.

  2024cites this paper
• Drug Discovery Approaches to Target E3 Ligases

  2024cites this paper
• Synergistic effects of Smac mimetic APG-1387 with anti-PD-1 antibody are attributed to increased CD3 + NK1.1 + cell recruitment secondary to induction of cytokines from tumor cells

  2024cites this paper
• The GSTP1/MAPKs/BIM/SMAC modulatory actions of nitazoxanide: Bioinformatics and experimental evidence in subcutaneous solid Ehrlich carcinoma-inoculated mice.

  2023cites this paper
• LLPS of SQSTM1/p62 and NBR1 as outcomes of lysosomal stress response limits cancer cell metastasis

  2023cites this paper
• Snail Promotes Cancer Cell Proliferation via Its Interaction with the BIRC3

  2022cites this paper
• Targeting YAP1/TAZ in nonsmall‐cell lung carcinoma: From molecular mechanisms to precision medicine

  2022cites this paper
• cIAP1/2 are involved in the radiosensitizing effect of birinapant on NSCLC cell line in vitro

  2021cites this paper
• Loss of cIAP1 in Endothelial Cells Limits Metastatic Extravasation through Tumor-Derived Lymphotoxin Alpha

  2021cites this paper
• Targeting cIAPs attenuates CCl4-induced liver fibrosis by increasing MMP9 expression derived from neutrophils.

  2021cites this paper
• Infantile Epithelioid Sarcoma with Genomic Segmental Amplification of BIRC3/YAP1 as Double Minutes Plus Trisomy 2: A Case Report

  2020cites this paper
• The multiple roles of the IAP super-family in cancer.

  2020cites this paper
• Future Therapeutic Directions for Smac-Mimetics

  2020cites this paper
• Feed-forward Regulatory Loop Driven by IRF4 and NF-κB in Adult T-cell Leukemia/Lymphoma.

  2020cites this paper
• Dysregulation of the Hippo pathway signaling in aging and cancer

  2019cites this paper
• Tumor cell-derived lymphotoxin alpha triggers metastatic extravasation through TNFRs/cIAP1

  2019cites this paper
• LncRNA HCP5 promotes triple negative breast cancer progression as a ceRNA to regulate BIRC3 by sponging miR‐219a‐5p

  2019cites this paper
• cIAP1 promotes proliferation and migration and prevents apoptosis in gallbladder cancer in vitro

  2019cites this paper
• Telbivudine Reduces Parvovirus B19-Induced Apoptosis in Circulating Angiogenic Cells

  2019cites this paper
• Mechanotransduction and Cytoskeleton Remodeling Shaping YAP1 in Gastric Tumorigenesis

  2019cites this paper
• SNIPERs-Hijacking IAP activity to induce protein degradation.

  2019cites this paper
• YAP/TAZ Activation as a Target for Treating Metastatic Cancer

  2018cites this paper
• A novel SMAC mimetic APG‐1387 exhibits dual antitumor effect on HBV‐positive hepatocellular carcinoma with high expression of cIAP2 by inducing apoptosis and enhancing innate anti‐tumor immunity

  2018cites this paper
• PKCι and YAP1 are crucial in promoting pancreatic tumorigenesis

  2018cites this paper
• The SMAC Mimetic APG-1387 Sensitizes Immune-Mediated Cell Apoptosis in Hepatocellular Carcinoma

  2018cites this paper
• Implication du récepteur à activité tyrosine kinase (RTK) MET sur la balance survie/apoptose et identification de nouvelles mutations de RTKs dans les cancers colorectaux métastatiques

  2018cites this paper
• NanoString, a novel digital color-coded barcode technology: current and future applications in molecular diagnostics

  2017cites this paper
• TNFα-YAP/p65-HK2 axis mediates breast cancer cell migration

  2017cites this paper
• Increased expression of YAP1 in prostate cancer correlates with extraprostatic extension

  2017cites this paper
• Etude de la signalisation Hippo/YAP dans les cellules gliales de Müller en conditions physiologiques et pathologiques de dégénérescence rétinienne chez la souris

  2017cites this paper
• cIAP2 promotes gallbladder cancer invasion and lymphangiogenesis by activating the NF‐κB pathway

  2017cites this paper
• Pellino-1 confers chemoresistance in lung cancer cells by upregulating cIAP2 through Lys63-mediated polyubiquitination

  2016cites this paper
• UvA-DARE ( Digital Academic Repository ) Clinical and molecular insights into primary pediatric liver cancer

  2016cites this paper
• LCL161 increases paclitaxel-induced apoptosis by degrading cIAP1 and cIAP2 in NSCLC

  2016cites this paper
• Yes-associated protein impacts adherens junction assembly through regulating actin cytoskeleton organization.

  2016cites this paper
• A nCounter CNV Assay to Detect HER2 Amplification: A Correlation Study with Immunohistochemistry and In Situ Hybridization in Advanced Gastric Cancer

  2016cites this paper
• Type I Interferon-Mediated Killing of Cancer Cells with IAP-Targeted Combination Immunotherapy

  2016cites this paper
• Differences in metabolic biomarkers in the blood and gene expression profiles of peripheral blood mononuclear cells among normal weight, mildly obese and moderately obese subjects

  2016cites this paper
• Emerging role of Hippo pathway in gastric and other gastrointestinal cancers.

  2016cites this paper
• YAPing Hippo Forecasts a New Target for Lung Cancer Prevention and Treatment.

  2015cites this paper
• Emerging role of Hpo signaling and YAP in hepatocellular carcinoma

  2015cites this paper
• Schädigung des Lungenepithels durch Zink- und Kadmiumchlorid - Eine Analyse am in-vitro-Modell der alveolar-kapillären Barriere

  2015cites this paper
• IAP Family of Proteins as Therapeutic Targets for Acute Myeloid Leukemia

  2015cites this paper
• Hippo signaling in stress response and homeostasis maintenance.

  2015cites this paper
• IAP antagonization promotes inflammatory destruction of vasculature endothelium and inhibits tumor growth

  2015cites this paper
• The NEXT-1 (Next generation pErsonalized tX with mulTi-omics and preclinical model) trial: prospective molecular screening trial of metastatic solid cancer patients, a feasibility analysis

  2015cites this paper
• Yes-associated protein in the liver: Regulation of hepatic development, repair, cell fate determination and tumorigenesis.

  2015cites this paper
• Birc2-Amplifikationen bei Plattenepithelkarzinomen des Kopf-Hals-Bereiches und deren Einfluss auf den Tumorphänotyp und die Patientenprognose

  2015cites this paper
• YAP1 acts as oncogenic target of 11q22 amplification in multiple cancer subtypes

  2014cites this paper
• Birinapant (TL32711), a Bivalent SMAC Mimetic, Targets TRAF2-Associated cIAPs, Abrogates TNF-Induced NF-κB Activation, and Is Active in Patient-Derived Xenograft Models

  2014cites this paper
• Novel Role of CHK2 in the Intrinsic and Extrinsic Apoptosis Pathway

  2014cites this paper
• Small-molecule SMAC mimetics as new cancer therapeutics.

  2014cites this paper
• Small Molecule Therapeutics Birinapant ( TL 32711 ) , a Bivalent SMAC Mimetic , Targets TRAF 2-Associated cIAPs , Abrogates TNF-Induced NFk B Activation , and Is Active in Patient-Derived Xenograft Models

  2014cites this paper
• SNP rs10248565 in HDAC9 as a novel genomic aberration biomarker of lung adenocarcinoma in non-smoking women

  2014cites this paper
• Cell Death and Cancer

  2014cites this paper
• High-Throughput Sequencing and Copy Number Variation Detection Using Formalin Fixed Embedded Tissue in Metastatic Gastric Cancer

  2014cites this paper
• Analyse des propriétés oncogéniques de cIAP1 : contribution de ses partenaires cdc42 et E2F1

  2014cites this paper
• Promoter methylation negatively correlated with mRNA expression but not tissue differential expression after heat stress.

  2013cites this paper
• Identification of TRPC6 as a possible candidate target gene within an amplicon at 11q21-q22.2 for migratory capacity in head and neck squamous cell carcinomas

  2013cites this paper
• IAP proteins as targets for drug development in oncology

  2013cites this paper
• cAMP/PKA signalling reinforces the LATS–YAP pathway to fully suppress YAP in response to actin cytoskeletal changes

  2013cites this paper
• We review the function of these different proteins , the incidence of mutations in their genes in carcinogenesis and as potential prognostic factors in sporadic and hereditary ovarian cancer

  2013cites this paper
• Cell death and life in cancer: mathematical modeling of cell fate decisions.

  2013cites this paper
• IAPs on the move: role of inhibitors of apoptosis proteins in cell migration

  2013cites this paper
• Drug Resistance and Molecular Cancer Therapy: Apoptosis Versus Autophagy

  2013cites this paper
• SMAC IAP Addiction in Cancer

  2013cites this paper
• The Role of TRAF1 in Signaling Downstream of 4-1BB on CD8 T Cells

  2013cites this paper
• The Inhibitor of Apoptosis (IAPs) in Adaptive Response to Cellular Stress

  2012cites this paper
• MAD1 and its life as a MYC antagonist: an update.

  2012cites this paper
• The Opposing Roles of Cellular Inhibitor of Apoptosis Proteins in Cancer

  2012cites this paper
• Expression of Yes-associated protein modulates Survivin expression in primary liver malignancies.

  2012cites this paper
• BIRC2 amplification in squamous cell carcinomas of the uterine cervix

  2012cites this paper
• Nuevos marcadores pronósticos en el linfoma difuso de célula grande b gástrico: expresión de proteinas y metilación de promotores

  2012cites this paper
• Targeting IAP proteins for therapeutic intervention in cancer

  2012cites this paper
• Genomic DNA Copy Number Alterations in Mouse Cancer Models and Human Cancer

  2012cites this paper
• Yes-Associated Protein Regulates the Hepatic Response After Bile Duct Ligation

  2012cites this paper
• Identification of cyclin B1 and Sec62 as biomarkers for recurrence in patients with HBV-related hepatocellular carcinoma after surgical resection

  2012cites this paper
• Negative regulation of Yap during neuronal differentiation.

  2012cites this paper
• The Human Epigenome

  2011cites this paper
• Identification of a tumor suppressor relay between the FOXP3 and the Hippo pathways in breast and prostate cancers.

  2011cites this paper
• BIRC2 (baculoviral IAP repeat-containing 2)

  2011cites this paper
• Apoptotic cell signaling in cancer progression and therapy.

  2011cites this paper
• Cellular Inhibitor of Apoptosis Protein-1 (cIAP1) Can Regulate E2F1 Transcription Factor-mediated Control of Cyclin Transcription*

  2011cites this paper
• Loss of 3 p 26 . 3 is an independent prognostic factor in patients with oral squamous cell carcinoma

  2011cites this paper
• The novel NF-κB inhibitor IMD-0354 induces apoptosis in chronic lymphocytic leukemia

  2011cites this paper
• Loss of 3p26.3 is an independent prognostic factor in patients with oral squamous cell carcinoma.

  2011cites this paper
• Integrated Analyses of Copy Number Variations and Gene Expression in Lung Adenocarcinoma

  2011cites this paper
• Molecular and Cellular Pathobiology Identification of a Tumor Suppressor Relay between the FOXP 3 and the Hippo Pathways in Breast and Prostate Cancers

  2011cites this paper
• Yes-Associated Protein 1 Exhibits Oncogenic Property in Gastric Cancer and Its Nuclear Accumulation Associates with Poor Prognosis

  2011cites this paper
• Association of germline or somatic TP53 missense mutation with oncogene amplification in tumors developed in patients with Li‐Fraumeni or Li‐Fraumeni‐like syndrome

  2011cites this paper
• The Hippo in the room: A new look at a key pathway in cell growth and transformation

  2010cites this paper
• IAPs: from caspase inhibitors to modulators of NF-κB, inflammation and cancer

  2010cites this paper
• Tissue specific DNA methylation of CpG islands in normal human adult somatic tissues distinguishes neural from non-neural tissues

  2010cites this paper
• Mild folate deficiency induces genetic and epigenetic instability and phenotype changes in prostate cancer cells

  2010cites this paper
• DNA fingerprinting techniques for the analysis of genetic and epigenetic alterations in colorectal cancer.

  2010cites this paper
• YAP1 and VGLL3, encoding two cofactors of TEAD transcription factors, are amplified and overexpressed in a subset of soft tissue sarcomas

  2010cites this paper
• Tristetraprolin controls the stability of cIAP2 mRNA through binding to the 3'UTR of cIAP2 mRNA.

  2010cites this paper
• Protein knockdown using methyl bestatin-ligand hybrid molecules: design and synthesis of inducers of ubiquitination-mediated degradation of cellular retinoic acid-binding proteins.

  2010cites this paper
• AGCA TTAAATGTATTATAACTTTA TACATTTAA TGCT TAATTCTAAAGTTTAGC AAATTTTT ATTTATTTA CAACTCAAAAAACATTGTTTTGGC TTTTTGAGTTG TAAATAAAT AAAAATTTTAAGGAAACCAAAC AAATTTTT AGCAGCA CAACTCAAAAAACATTGTTTTGGC TTTTTGAGTTG TGCATGCT AAAAATTTTAAGGAAACCAAAC TAACAT ATTTA TATATGTATCTAAACCATGC ACATATA TAAAT ATGTTACACAAAACAATG

  2010cites this paper