The role of indigenous yeasts in traditional Irish cider fermentations

No abstract is available for this paper.

• Publication year

  2004

• Venue

  Journal of Applied Microbiology

• Publication date

  2004-09-01

• Fields of study

  Agricultural and Food Sciences, Medicine, Biology, Environmental Science

• Identifiers
  DOI 10.1111/j.1365-2672.2004.02354.xPMID 15281947
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• Yeast interactions and wine flavour.

  2003cited by this paper
• Isolation and identification of yeasts associated with vineyard and winery by RFLP analysis of ribosomal genes and mitochondrial DNA.

  2002cited by this paper
• Saccharomyces cerevisiae and Saccharomyces paradoxus coexist in a natural woodland site in North America and display different levels of reproductive isolation from European conspecifics.

  2002cited by this paper
• and coexist in a natural woodland site in North America and display different levels of reproductive isolation from European conspecifics

  2002cited by this paper
• Molecular taxonomy of yeasts.

  1999cited by this paper
• Microorganisms in food ecosystems.

  1999cited by this paper
• Restriction enzyme analysis of PCR amplified rDNA as a taxonomic tool in yeast identification.

  1999cited by this paper
• On the origins of wine yeast.

  1999cited by this paper
• Identification of yeasts by RFLP analysis of the 5.8S rRNA gene and the two ribosomal internal transcribed spacers.

  1999cited by this paper
• Synthesis of higher alcohols during cider processing

  1999cited by this paper
• Rapid identification of wine yeast species based on RFLP analysis of the ribosomal internal transcribed spacer (ITS) region

  1998cited by this paper
• INCIDENCE OF INDIGENOUS MICROBIAL FLORA FROM UTENSILS AND SURROUNDING AIR IN TRADITIONAL FRENCH CIDER MAKING

  1998cited by this paper
• Facts, myths and legends on the prime industrial microorganism

  1995cited by this paper
• 5 – Yeasts in Cider-Making

  1993cited by this paper
• Origin and domestication of the wine yeast Saccharomyces cerevisiae

  1993cited by this paper
• The taxonomy of the genus Saccharomyces meyen ex reess: A short review for non‐taxonomists

  1992cited by this paper
• Ecological Survey of Wine Yeast Strains by Molecular Methods of Identification

  1992cited by this paper
• Growth of yeasts during wine fermentations

  1990cited by this paper
• Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics

  1990cited by this paper
• A survey of microbiological aspects of cider making

  1988cited by this paper
• Flore levurienne présente dans les cidreries de l'ouest de la France

  1988cited by this paper
• Growth of Natural Yeast Flora during the Fermentation of Inoculated Wines

  1985cited by this paper
• FLAVOUR RESEARCH AND THE CIDER INDUSTRY

  1974cited by this paper
• The yeasts : a taxonomic study

  1972cited by this paper
• STATISTICAL METHODS

  1967cited by this paper

• Enhancement of dry-hopped cider aroma through selection of apple cultivar, hop variety and yeast strain.

  2025cites this paper
• Kefir alternatives, an innovative source of probiotics: microbiological, technological, and therapeutical properties

  2025cites this paper
• The Nutritional Profile of Root Vegetables Through Spontaneous Fermentation with Apples: Amino Acid Composition and Microbial Dynamics

  2025cites this paper
• Study and characterization of a product based on a vegetable extract of quinoa fermented with water kefir grains

  2024cites this paper
• Richness of yeast community associated with apple fruits in Estonia

  2024cites this paper
• Physiological evaluation of yeast strains under anaerobic conditions using glucose, fructose, or sucrose as the carbon source.

  2024cites this paper
• Polyphenols Profile and Antioxidant Activity Characterization of Commercial North Italian Ciders in Relation to Their Geographical Area of Production and Cidermaking Procedures

  2023cites this paper
• Appeal of the Apple: Exploring Consumer Perceptions of Hard Cider in the Northeast and Mid-Atlantic United States

  2023cites this paper
• Exploring future applications of the apiculate yeast Hanseniaspora

  2023cites this paper
• New insights into the role of key microorganisms and wooden barrels during lambic beer fermentation and maturation.

  2023cites this paper
• Torulaspora delbrueckii Strain Behaviour within Different Refermentation Strategies for Sparkling Cider Production

  2023cites this paper
• Mosaic Genome of a British Cider Yeast

  2023cites this paper
• Brettanomyces bruxellensis: Overview of the genetic and phenotypic diversity of an anthropized yeast

  2022cites this paper
• Exploring Use of the Metschnikowia pulcherrima Clade to Improve Properties of Fruit Wines

  2022cites this paper
• Do Kombucha Symbiotic Cultures of Bacteria and Yeast Affect Bacterial Cellulose Yield in Molasses?

  2021cites this paper
• Saccharomyces and Their Potential Applications in Food and Food Processing Industries

  2021cites this paper
• Anti-Platelet Properties of Apple Must/Skin Yeasts and of Their Fermented Apple Cider Products

  2021cites this paper
• Plant compounds for the potential reduction of food waste – a focus on antimicrobial peptides

  2021cites this paper
• Mutagenesis, screening and isolation of Brettanomyces bruxellensis mutants with reduced 4-ethylphenol production

  2021cites this paper
• Biotechnological Processes in Fruit Vinegar Production

  2021cites this paper
• Use of non-Saccharomyces yeasts in cider fermentation: Importance of the nutrients addition to obtain an efficient fermentation.

  2021cites this paper
• Evaluation of cryotolerant yeasts for the elaboration of a fermented pear beverage in Patagonia: Physicochemical and sensory attributes.

  2021cites this paper
• An Overview of the Factors Influencing Apple Cider Sensory and Microbial Quality from Raw Materials to Emerging Processing Technologies

  2021cites this paper
• Technological and Environmental Features Determine the Uniqueness of the Lambic Beer Microbiota and Production Process

  2021cites this paper
• Development of fermented beverage with water kefir in water-soluble coconut extract (Cocos nucifera L.) with inulin addition

  2021cites this paper
• Lactose utilization by Brettanomyces claussenii expands potential for valorization of dairy by-products to functional beverages through fermentation

  2021cites this paper
• Alternative source of probiotics for lactose intolerance and vegan individuals: sugary kefir

  2020cites this paper
• Human-associated migration of Holarctic Saccharomyces uvarum strains to Patagonia

  2020cites this paper
• Fermentation technology as a driver of human brain expansion

  2020cites this paper
• Impact of the Physicochemical Composition and Microbial Diversity in Apple Juice Fermentation Process: A Review

  2020cites this paper
• The Quality of Ciders Depends on the Must Supplementation with Mineral Salts

  2020cites this paper
• Evaluation of the fermentative capacity of an indigenous Hanseniaspora sp. strain isolated from Lebanese apples for cider production.

  2020cites this paper
• Microbiological and technological parameters impacting the chemical composition and sensory quality of kombucha.

  2020cites this paper
• Saccharomyces uvarum isolated from patagonian ciders shows excellent fermentative performance for low temperature cidermaking.

  2019cites this paper
• Yeasts in Fruit Wine Fermentation

  2019cites this paper
• Assessment of yeasts for apple juice fermentation and production of cider volatile compounds

  2019cites this paper
• Use of Non-Saccharomyces Yeasts in Red Winemaking

  2019cites this paper
• Microbial Diversity on Grapes and Other Fruits: Role and Significance in Fermentation

  2019cites this paper
• Occurrence of Brettanomyces bruxellensis on Grape Berries and in Related Winemaking Cellar

  2019cites this paper
• The biotechnological potential of the yeast Dekkera bruxellensis

  2019cites this paper
• Perspectives and Uses of Non-Saccharomyces Yeasts in Fermented Beverages

  2018cites this paper
• Biocontrol activity of Starmerella bacillaris yeast against blue mold disease on apple fruit and its effect on cider fermentation

  2018cites this paper
• Brettanomyces bruxellensis SSU1 Haplotypes Confer Different Levels of Sulfite Tolerance When Expressed in a Saccharomyces cerevisiae SSU1 Null Mutant

  2018cites this paper
• Major Qualifying Project: Apple Yeast Investigation

  2018cites this paper
• Yeast species diversity in apple juice for cider production evidenced by culture-based method

  2018cites this paper
• On the origins and industrial applications of Saccharomyces cerevisiae × Saccharomyces kudriavzevii hybrids

  2018cites this paper
• Yeast habitats: Different but global

  2017cites this paper
• Physiological characterization of Saccharomyces uvarum and Saccharomyces eubayanus from Patagonia and their potential for cidermaking.

  2017cites this paper
• Microorganisms in Fermented Apple Beverages: Current Knowledge and Future Directions

  2017influential citation
• Microbiological, biochemical, and functional aspects of sugary kefir fermentation - A review.

  2017cites this paper
• Improved cider fermentation performance and quality with newly generated Saccharomyces cerevisiae × Saccharomyces eubayanus hybrids

  2017cites this paper
• TCTACCATAGCCAATCAAAG CCAGACTTAGAGCTGATGAC GCTTACAGCACCTAAAGATG GGCTCAAATTTAGCACCATC TTGACATGTTCGAGGTGTTC GATCCCTGCTTTACTTGAC 9 AACTAAGGCAGTATCCAAAG GGTTTAGCAGAATCTTTAGC TGCCTACCTTAAATTCTCAC GCAGCTGATCTATCACTTTG TGGAATAACGGAGTGAATAC GTCATGTTCTTCACCATACC 10 AAATGGCCGAAACCATTGGG CTTGTGTTGTTGCTGAATAC AT

  2017cites this paper
• Glycolytic Functions Are Conserved in the Genome of the Wine Yeast Hanseniaspora uvarum, and Pyruvate Kinase Limits Its Capacity for Alcoholic Fermentation

  2017cites this paper
• Yeasts and Traditional Fermented Foods and Beverages

  2017cites this paper
• Yeast and volatile evolution in cider co-fermentation with Saccharomyces cerevisiae and Williopsis saturnus

  2016cites this paper
• Saccharomyces in Traditional and Industrial Fermentations from Patagonia

  2016cites this paper
• Global analysis of the genetic and epigenetic contributions to phenotypic plasticity in a wild yeast strain

  2016cites this paper
• Nutritional requirements and survival of the red wine spoilage yeast Brettanomyces bruxellensis

  2016influential citation
• Brettanomyces bruxellensis, a survivalist prepared for the wine apocalypse and other beverages.

  2016cites this paper
• Apple and Blueberry Synergies for Designing Bioactive Ingredients for the Management of Early Stages of Type 2 Diabetes

  2016cites this paper
• Strain-dependent tolerance to acetic acid in Dekkera bruxellensis

  2016cites this paper
• Brettanomyces yeasts--From spoilage organisms to valuable contributors to industrial fermentations.

  2015cites this paper
• Yeast identification and characterization

  2015cites this paper
• Comparative phenomics and targeted use of genomics reveals variation in carbon and nitrogen assimilation among different Brettanomyces bruxellensis strains

  2015cites this paper
• Harnessing improved understanding of Brettanomyces bruxellensis biology to mitigate the risk of wine spoilage

  2015cites this paper
• Bioflocs: A novel bioformulation of PGPR cells with higher degree of stress tolerance

  2015cites this paper
• Genomic insights into the evolution of industrial yeast species Brettanomyces bruxellensis.

  2014cites this paper
• Saccharomyces eubayanus and Saccharomyces uvarum associated with the fermentation of Araucaria araucana seeds in Patagonia.

  2014cites this paper
• Changes in the profile of volatile compounds and amino acids during cider fermentation using dessert variety of apples

  2014cites this paper
• Efecto de la aireación en la producción de compuestos volátiles por cultivo mixto de Brettanomyces intermedius y Saccharomyces cerevisiae durante la fermentación de sidra

  2014cites this paper
• Wine, Beer and Cider: Unravelling the Aroma Profile

  2014cites this paper
• Application of FT-NIR Spectroscopy to Apple Wine for Rapid Simultaneous Determination of Soluble Solids Content, pH, Total Acidity, and Total Ester Content

  2014cites this paper
• Preparation and evaluation of tea cider

  2014cites this paper
• Characterization of yeast starter cultures used in household alcoholic beverage preparation by a few ethnic communities of Northeast India

  2013cites this paper
• Population dynamics of mixed cultures of yeast and lactic acid bacteria in cider conditions

  2013cites this paper
• Comparison of Methods for Identification of Yeasts Isolated during Spontaneous Fermentation of Freshly Crushed Pineapple Juices

  2013cites this paper
• Osmotic stress response in the wine yeast Dekkera bruxellensis.

  2013cites this paper
• Antioxidant properties and phenolic compounds of fermented Bambangan (Mangifera pajang)

  2013cites this paper
• Role of social wasps in Saccharomyces cerevisiae ecology and evolution

  2012cites this paper
• Identification of yeast and acetic acid bacteria isolated from the fermentation and acetification of persimmon (Diospyros kaki).

  2012cites this paper
• Evaluation of ITS PCR and RFLP for Differentiation and Identification of Brewing Yeast and Brewery ‘Wild’ Yeast Contaminants

  2012cites this paper
• De-Novo Assembly and Analysis of the Heterozygous Triploid Genome of the Wine Spoilage Yeast Dekkera bruxellensis AWRI1499

  2012cites this paper
• Microbiological analysis and control of the fruit vinegar production process

  2012cites this paper
• De-Novo Assembly and Analysis of the Heterozygous Triploid Genome of the Wine Spoilage Yeast Dekkera bruxellensis AWRI 1499

  2012cites this paper
• Preliminary prospection of the yeast biodiversity on apple and pear surfaces from Northern Italy orchards

  2011cites this paper
• Detection and enumeration of Dekkera anomala in beer, cola, and cider using real‐time PCR

  2011cites this paper
• Screening of representative cider yeasts and bacteria for volatile phenol-production ability.

  2011cites this paper
• A global phylogeographic survey of Sccharomyces uvarum

  2011cites this paper
• A global phylogeographic survey of Saccharomyces uvarum

  2011cites this paper
• Influence des fermentations alcoolique et malolactique sur la composition chimique des cidres à distiller en cours d'élaboration.

  2011cites this paper
• Chitosane : un nouvel outil pour lutter contre Brettanomyces et préserver les qualités aromatiques des vins

  2011cites this paper
• Charakterystyka cech smakowo-zapachowych nowych napojów typu cydr i calvados

  2011cites this paper
• Genetic and phenotypic diversity of autochthonous cider yeasts in a cellar from Asturias.

  2010cites this paper
• Diversity of Fermented Beverages and Alcoholic Drinks

  2010cites this paper
• Diversidad de levaduras asociadas a chichas tradicionales

  2010cites this paper
• Yeast diversity associated to Colombian traditional "chichas"

  2010cites this paper
• Population dynamics of lactic acid bacteria during spontaneous malolactic fermentation in industrial cider

  2010cites this paper
• Diversidad de levaduras asociadas a chichas tradicionales de Colombia

  2010cites this paper
• Einsatz molekularer Methoden für Starterkulturen

  2010cites this paper
• Autochthonous yeasts associated with mature pineapple fruits, freshly crushed juice and their ferments; and the chemical changes during natural fermentation.

  2010cites this paper