Enhancement of Wx Gene Expression and the Accumulation of Amylose in Response to Cool Temperatures during Seed Development in Rice

No abstract is available for this paper.

• Publication year

  1998

• Venue

  Plant and Cell Physiology

• Publication date

  1998-08-01

• Fields of study

  Biology, Environmental Science

• Identifiers
  DOI 10.1093/OXFORDJOURNALS.PCP.A029438
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar

• No claims are published for this paper.

• No concepts are published for this paper.

• Molecular Cloning: A Laboratory Manual

  2001cited by this paper
• A single base change altered the regulation of the Waxy gene at the posttranscriptional level during the domestication of rice.

  1998cited by this paper
• Retrotransposon insertion into the maize waxy gene results in tissue-specific RNA processing.

  1997cited by this paper
• Tissue-Dependent Expression of the Rice wx+ Gene Promoter in Transgenic Rice and Petunia

  1995cited by this paper
• The amylose content in rice endosperm is related to the post-transcriptional regulation of the waxy gene.

  1995cited by this paper
• Formation and Deposition of Amylose in the Potato Tuber Starch Granule Are Affected by the Reduction of Granule-Bound Starch Synthase Gene Expression.

  1994cited by this paper
• Characterization of cDNAs encoding two isoforms of granule-bound starch synthase which show differential expression in developing storage organs of pea and potato.

  1992cited by this paper
• Molecular Characterization of the waxy Locus of Rice (Oryza sativa)

  1991cited by this paper
• Evolutionary significances of differential regulation at the wx locus of rice

  1991cited by this paper
• The Roles of Heat Shock Proteins in Plants

  1991cited by this paper
• Cold Acclimation and Freezing Stress Tolerance: Role of Protein Metabolism

  1990cited by this paper
• Variation of the intergenic spacer region of ribosomal DNA in cultivated and wild rice species.

  1990cited by this paper
• Temperature Response of Amylose Content in Rice Varieties of Hokkaido

  1988cited by this paper
• Effect of environmental temperature at the milky stage on amylose content and fine structure of amylopectin of waxy and nonwaxy endosperm starches of rice (Oryza sativa L.)

  1985cited by this paper
• Partial purification and characterization of granule-bound starch synthases from normal and waxy maize.

  1985cited by this paper
• Temperature effects on the Wx protein level and amylose content in the endosperm of rice

  1985cited by this paper
• Effect of Environmental Temperature During Development of Rice Plants on Some Properties of Endosperm Starch

  1984cited by this paper
• Improvement of the Quality of Rice Grown in Hokkaido

  1979cited by this paper
• The enzymatic deficiency in the waxy mutant of maize.

  1962cited by this paper

• Food as Medicine: Curbing Type-2 Diabetes Prevalence Through Consumption of High Amylose Starchy Foods in Sub-Saharan Africa

  2025cites this paper
• Physiological and compensatory roles of three starch-branching enzymes in different rice organs

  2025cites this paper
• Characteristics of Wheat Noodle “Kitanokaori” Using Weakly Acidic Hard Water in Terms of Functional Qualities, Such as Inhibiting Postprandial Abrupt Increase in Blood Glucose

  2025cites this paper
• Interaction between genetic regions responsible for the starch properties in non-glutinous rice varieties in Hokkaido, Japan

  2024cites this paper
• Correlation among Quality Characteristics in Medium-Grain Rice

  2023cites this paper
• Effect of Heading Date on the Starch Structure and Grain Yield of Rice Lines with Low Gelatinization Temperature

  2022cites this paper
• Resistant starch formation in rice: Genetic regulation and beyond

  2022cites this paper
• Ripening rice grains under low temperature for the high loaf volume and slow firming of gluten-free rice bread without additives

  2022cites this paper
• Extreme Low-Temperature Stress Affects Nutritional Quality of Amino Acids in Rice

  2022cites this paper
• Improving Agricultural Traits While Maintaining High Resistant Starch Content in Rice

  2022cites this paper
• Starch Bio-Synthetic Pathway Genes Contribute to Resistant Starch Content Differentiation in Bread Wheat

  2022cites this paper
• Efficient Breeding of Early-Maturing Rice Cultivar by Editing PHYC via CRISPR/Cas9

  2021cites this paper
• Evaluation of Hardness and Retrogradation of Cooked Rice Based on Its Pasting Properties Using a Novel RVA Testing

  2021cites this paper
• Glycemic index of starchy crops and factors affecting its digestibility: A review

  2021cites this paper
• Characterization and differential expression of sucrose and starch metabolism genes in contrasting chickpea (Cicer arietinum L.) genotypes under low temperature

  2021cites this paper
• Characterization and differential expression of sucrose and starch metabolism genes in contrasting chickpea (Cicer arietinum L.) genotypes under low temperature

  2021cites this paper
• Characteristics of Physicochemical Properties of Chalky Grains of Japonica Rice Generated by High Temperature during Ripening

  2021cites this paper
• Genetic Control and High Temperature Effects on Starch Biosynthesis and Grain Quality in Rice

  2021cites this paper
• Yield, Grain Quality, and Starch Physicochemical Properties of 2 Elite Thai Rice Cultivars Grown under Varying Production Systems and Soil Characteristics

  2021cites this paper
• Allelic variations of the Wx locus in cultivated rice and their use in the development of hybrid rice in China

  2020cites this paper
• Rice used for Japanese sake making

  2019cites this paper
• CRISPR/Cas9 mutations in the rice Waxy/GBSSI gene induce allele-specific and zygosity-dependent feedback effects on endosperm starch biosynthesis

  2019cites this paper
• Starch Source and Its Impact on Pharmaceutical Applications

  2019cites this paper
• Temperature Extremes: Impact on Rice Growth and Development

  2019cites this paper
• Effect of high temperature on starch biosynthetic enzymes and starch structure in japonica rice cultivar ‘Akitakomachi’ (Oryza sativa L.) endosperm and palatability of cooked rice

  2019cites this paper
• Effects of variety and growth location on the chain-length distribution of rice starches

  2019cites this paper
• Starch Synthase IIa-Deficient Mutant Rice Line Produces Endosperm Starch With Lower Gelatinization Temperature Than Japonica Rice Cultivars

  2018cites this paper
• Effects of open-field warming during grain-filling stage on grain quality of two japonica rice cultivars in lower reaches of Yangtze River delta

  2018cites this paper
• Genes Affecting Eating and Processing Qualities

  2018cites this paper
• Analyses of starch biosynthetic protein complexes and starch properties from developing mutant rice seeds with minimal starch synthase activities

  2018cites this paper
• Influences of irrigation, nitrogen and zeolite management on the physicochemical properties of rice

  2017cites this paper
• Differential Regulation of Starch-synthetic Gene Expression in Endosperm Between Indica and Japonica Rice Cultivars

  2017influential citation
• Thermal stress impacts reproductive development and grain yield in rice.

  2017cites this paper
• Characterization of the endosperm starch and the pleiotropic effects of biosynthetic enzymes on their properties in novel mutant rice lines with high resistant starch and amylose content.

  2017cites this paper
• Rice Interploidy Crosses Disrupt Epigenetic Regulation, Gene Expression, and Seed Development.

  2017cites this paper
• In silico promoter analysis reveals rice Wx promoter could be a TATA-less promoter with a putative pyrimidine rich region

  2017cites this paper
• Development of formulae for estimating amylose content and resistant starch content based on the pasting properties measured by RVA of Japonica polished rice and starch

  2016cites this paper
• Advances to improve the eating and cooking qualities of rice by marker-assisted breeding

  2016cites this paper
• Impact of environmental factors on rice starch structure: A review

  2015cites this paper
• Obtaining a black pericarp and improved aroma using genetic resources from Leum Pua rice.

  2015cites this paper
• Development of formulae for estimating amylose content, amylopectin chain length distribution, and resistant starch content based on the iodine absorption curve of rice starch

  2015cites this paper
• Manipulation of Rice Starch Properties for Application

  2015cites this paper
• Recent Advances in Biotechnology and Genomic Approaches for Abiotic Stress Tolerance in Crop Plants

  2015cites this paper
• Effect of high temperature on grain filling period, yield, amylose content and activity of starch biosynthesis enzymes in endosperm of basmati rice.

  2015cites this paper
• Designing climate-resilient rice with ideal grain quality suited for high-temperature stress.

  2015cites this paper
• Genetic Engineering of Field, Industrial and Pharmaceutical Crops

  2014cites this paper
• Effects of allelic variations in starch synthesis-related genes on grain quality traits of Korean nonglutinous rice varieties under different temperature conditions

  2014cites this paper
• Major QTLs reduce the deleterious effects of high temperature on rice amylose content by increasing splicing efficiency of Wx pre-mRNA

  2014influential citation
• Effects of Rice Variety and Growth Location in Cambodia on Grain Composition and Starch Structure

  2014cites this paper
• Genome-Wide Comparative Transcriptional Analysis of Developing Seeds among Seven Oryza sativa L. Subsp. Japonica Cultivars Grown near the Northern Limit of Rice Cultivation

  2014cites this paper
• Influence of Early and Delayed Transplantation of Paddy on Physicochemical, Pasting, Cooking, Textural, and Protein Characteristics of Milled Rice

  2014cites this paper
• In-depth proteomic analysis of rice embryo reveals its important roles in seed germination.

  2014cites this paper
• Improvement of Cereal Crops through Androgenesis and Transgenic Approaches for Abiotic Stress Tolerance to Mitigate the Challenges of Climate Change in Sustainable Agriculture

  2013cites this paper
• TCCATCAACAAG GGCATGACAAACCCGTGAAAGG TTTGTCAGTGGCCGGATTCCAC AGGGAAGTTCACCCGTCAACAC GCTTGAAGTGGCCAATGGCTTG AGTGCAGGCACCAGGAAAGTTAC TCCAGCGAGAACCACCACTTTC TGGGCTTCCCTTTGTTGTGGAC AGTCTCCGGAGTTCCTTAACAGG AGAAGCCCTCCAAGCAGAAGTC TCGCTATTCCTCGGGCTTTGTC AAAGGTTGTTGTGGCGGTCTGC TGT GCTCAGCAACTTCGTCACC AGACGCTG

  2013cites this paper
• Cooking quality of upland brown rice grown in Kota Belud

  2013cites this paper
• Temperature during grain ripening affects the ratio of type-II/type-I protein body and starch pasting properties of rice (Oryza sativa L.)

  2013cites this paper
• Gene expression and biochemical changes of carbohydrate metabolism in in vitro micro-propagated apple plantlets infected by 'Candidatus Phytoplasma mali'.

  2013cites this paper
• Molecular and environmental factors determining grain quality in rice

  2012cites this paper
• Anthology of Anther/Pollen-Specific Promoters and Transcription Factors

  2012influential citation
• Toward Understanding the Genetic and Molecular Bases of the Eating and Cooking Qualities of Rice 1

  2012cites this paper
• Detection of allelic variation at the Wx locus with single-segment substitution lines in rice (Oryza sativa L.)

  2012cites this paper
• Effects of environmental factors on cereal starch biosynthesis and composition

  2012cites this paper
• Toward Understanding the Genetic and Molecular Bases of the Eating and Cooking Qualities of Rice

  2012cites this paper
• EFFECT OF HIGH TEMPERATURE ON THE ENZYMATIC ACTIVITIES AND TRANSCRIPTIONAL EXPRESSION OF STARCH DEBRANCHING ENZYME (DBE) MUTIPLE ISOFORMS IN DEVELOPING RICE ENDOSPERMS

  2012cites this paper
• High-Temperature Effects on Rice Growth, Yield, and Grain Quality

  2011cites this paper
• Recent molecular advances to combat abiotic stress tolerance in crop plants

  2011cites this paper
• Comparison of starch levels reduced by high temperature during ripening in Japonica rice lines near-isogenic for the Wx locus.

  2010cites this paper
• The reduction of amylose content in rice grain and decrease of Wx gene expression during endosperm development in response to drought stress

  2010cites this paper
• Development of SNP-based CAPS and dCAPS markers in eight different genes involved in starch biosynthesis in rice

  2009cites this paper
• Production of a fully waxy line and analysis of waxy genes in the allohexaploid crop, Japanese barnyard millet

  2009cites this paper
• Influence of Starch Characteristics on Digestibility of Steamed Rice Grains under Sake-making Conditions, and Rapid Estimation Methods of Digestibility by Physical Analysis

  2009cites this paper
• 登熟温度が米のアミロペクチン単位鎖長分布と超長鎖(LC)含量に及ぼす影響

  2008cites this paper
• Rice End-Use Quality

  2008cites this paper
• Abiotic Stress Tolerance in Rice

  2008cites this paper
• Comparison of physical and chemical properties of medium-grain rice cultivars grown in California and Arkansas.

  2008cites this paper
• Effects of Variations in Starch Synthase on Starch Properties and Eating Quality of Rice

  2008cites this paper
• Effects of low temperature on grain filling, amylose content, and activity of starch biosynthesis enzymes in endosperm of basmati rice

  2008cites this paper
• Molecular regulation of starch accumulation in rice seedling leaves in response to salt stress

  2008cites this paper
• Comparison between locations of QTLs for grain chalkiness and genes responsive to high temperature during grain filling on the rice chromosome map

  2008cites this paper
• Characterization of novel rice germplasm from West Africa and genetic marker associations with rice cooking quality

  2006cites this paper
• Regulations of granule-bound starch synthase I gene expression in rice leaves by temperature and drought stress

  2006cites this paper
• METABOLIC ENGINEERING FOR STRESS TOLERANCE

  2006cites this paper
• Physiology and molecular biology of stress tolerance in plants

  2006cites this paper
• Structural and Retrogradation Properties of Rice Endosperm Starch Affect Enzyme Digestibility of Steamed Milled-Rice Grains Used in Sake Production

  2006cites this paper
• Effect of growth location in the United States on amylose content, amylopectin fine structure, and thermal properties of starches of long grain rice cultivars.

  2006cites this paper
• The main effects, epistatic effects and environmental interactions of QTLs on the cooking and eating quality of rice in a doubled-haploid line population

  2005cites this paper
• Rice Milling Quality, Grain Dimensions, and Starch Branching as Affected by High Night Temperatures

  2005cites this paper
• Temperature induced changes in the starch components and biosynthetic enzymes of two rice varieties

  2005cites this paper
• CHAPTER 2: THE RICE PLANT: GROWTH, DEVELOPMENT, AND GENETIC IMPROVEMENT

  2004cites this paper
• Isolation and characterization of a rice mutant insensitive to cool temperatures on amylose synthesis

  2004influential citation
• Functional Genomics for Tolerance to Abiotic Stress in Cereals

  2004cites this paper
• Analysis of genotypic and environmental effects on rice starch. 1. Apparent amylose content, pasting viscosity, and gel texture.

  2004cites this paper
• CHAPTER 4: THE RICE GRAIN AND ITS GROSS COMPOSITION

  2004cites this paper
• Sensory Characteristics of Diverse Rice Cultivars as Influenced by Genetic and Environmental Factors

  2004cites this paper
• Differences in starch characteristics of rice strains having different sensitivities to maturation temperatures

  2004cites this paper
• Increase in Apparent Amylose Content and Change in Starch Pasting Properties at Cool Growth Temperatures in Mutant Wheat

  2004cites this paper
• Identification of SNPs in the waxy gene among glutinous rice cultivars and their evolutionary significance during the domestication process of rice

  2004cites this paper
• Molecular Dissection of Abiotic Stress Tolerance in Sorghum and Rice

  2004cites this paper
• Starch Characteristics of the Rice Mutant du2-2 Taichung 65 Highly Affected by Environmental Temperatures During Seed Development

  2003cites this paper
• Duplicated coding sequence in the waxy allele of tropical glutinous rice (Oryza sativa L.)

  2003cites this paper