Inhibition of CCAAT/enhancer binding protein δ expression by chrysin in microglial cells results in anti‐inflammatory and neuroprotective effects

No abstract is available for this paper.

• Publication year

  2010

• Venue

  Journal of Neurochemistry

• Publication date

  2010-10-01

• Fields of study

  Biology, Medicine

• Identifiers
  DOI 10.1111/j.1471-4159.2010.06952.xPMID 20722966
• External record

  Open on Semantic Scholar

• Source metadata

  Semantic Scholar, PubMed

• No claims are published for this paper.

• No concepts are published for this paper.

• CCAAT/enhancer binding protein delta in microglial activation

  2010cited by this paper
• Microglia enhance manganese chloride-induced dopaminergic neurodegeneration: role of free radical generation.

  2009cited by this paper
• Food flavonoid aryl hydrocarbon receptor-mediated agonistic/antagonistic/synergic activities in human and rat reporter gene assays.

  2009cited by this paper
• Hypersensitivity of Aryl Hydrocarbon Receptor-Deficient Mice to Lipopolysaccharide-Induced Septic Shock

  2009cited by this paper
• Neuroprotective and neurotoxic properties of glial cells in the pathogenesis of Alzheimer's disease

  2008cited by this paper
• Suppressive effects of flavonoid fisetin on lipopolysaccharide-induced microglial activation and neurotoxicity.

  2008cited by this paper
• Catalpol attenuates the neurotoxicity induced by beta-amyloid(1-42) in cortical neuron-glia cultures.

  2008cited by this paper
• The neuroprotective potential of flavonoids: a multiplicity of effects

  2008cited by this paper
• The mouse C/EBPδ gene promoter is regulated by STAT3 and Sp1 transcriptional activators, chromatin remodeling and c‐Myc repression

  2007cited by this paper
• Glial cells as intrinsic components of non-cell-autonomous neurodegenerative disease

  2007cited by this paper
• Neuroinflammation and its modulation by flavonoids.

  2007cited by this paper
• Role of transcriptional factors Sp1, c-Rel, and c-Jun in LPS-induced C/EBPδ gene expression of mouse macrophages

  2007cited by this paper
• Sinomenine, a natural dextrorotatory morphinan analog, is anti-inflammatory and neuroprotective through inhibition of microglial NADPH oxidase

  2007cited by this paper
• Upregulation of CCAAT/enhancer binding protein β in activated astrocytes and microglia

  2007cited by this paper
• Inflammation as a causative factor in the aetiology of Parkinson's disease

  2007cited by this paper
• CCAAT/enhancer binding protein‐α is down‐regulated by toll‐like receptor agonists in microglial cells

  2007cited by this paper
• Regulation of Inducible Nitric Oxide Synthase Gene in Glial Cells

  2006cited by this paper
• Luteolin and chrysin differentially inhibit cyclooxygenase-2 expression and scavenge reactive oxygen species but similarly inhibit prostaglandin-E2 formation in RAW 264.7 cells.

  2006cited by this paper
• Rosiglitazone and 15-deoxy-Δ12,14-prostaglandin J2 Cause Potent Neuroprotection after Experimental Stroke through Noncompletely Overlapping Mechanisms

  2006cited by this paper
• Differential inhibitory effects of baicalein and baicalin on LPS-induced cyclooxygenase-2 expression through inhibition of C/EBPbeta DNA-binding activity.

  2006cited by this paper
• The role of inflammation in CNS injury and disease

  2006cited by this paper
• Signalling networks regulating cyclooxygenase-2.

  2006cited by this paper
• Expression of C/EBPalpha and C/EBPbeta in glial cells in vitro after inducing glial activation by different stimuli.

  2006cited by this paper
• Expression of C/EBPα and C/EBPβ in glial cells in vitro after inducing glial activation by different stimuli

  2006cited by this paper
• Nitric oxide from inflammatory‐activated glia synergizes with hypoxia to induce neuronal death

  2005cited by this paper
• Inhibition of thrombin‐induced microglial activation and NADPH oxidase by minocycline protects dopaminergic neurons in the substantia nigra in vivo

  2005cited by this paper
• Microglia and multiple sclerosis

  2005cited by this paper
• Nonsteroidal antiinflammatory drug use and the risk for Parkinson's disease

  2005cited by this paper
• Chrysin suppresses lipopolysaccharide‐induced cyclooxygenase‐2 expression through the inhibition of nuclear factor for IL‐6 (NF‐IL6) DNA‐binding activity

  2005cited by this paper
• Novel therapeutic opportunities for Alzheimer's disease: focus on nonsteroidal anti‐inflammatory drugs

  2005cited by this paper
• Inhibition of microglial activation by the herbal flavonoid baicalein attenuates inflammation-mediated degeneration of dopaminergic neurons

  2005cited by this paper
• Microglia as potential contributors to motor neuron injury in amyotrophic lateral sclerosis

  2005cited by this paper
• Inhibition of inducible nitric oxide synthase expression by baicalein in endotoxin/cytokine-stimulated microglia.

  2004cited by this paper
• Minocycline inhibits apoptotic cell death via attenuation of TNF‐α expression following iNOS/NO induction by lipopolysaccharide in neuron/glia co‐cultures

  2004cited by this paper
• CCAAT/enhancer binding protein delta (C/EBPdelta) expression and elevation in Alzheimer's disease.

  2004cited by this paper
• Nonsteroidal Anti-Inflammatory Drugs for the Prevention of Alzheimer’s Disease: A Systematic Review

  2004cited by this paper
• Modulation of the activity of pro-inflammatory enzymes, COX-2 and iNOS, by chrysin derivatives.

  2004influential reference
• Glial activation modulates glutamate neurotoxicity in cerebellar granule cell cultures

  2004cited by this paper
• CCAAT/enhancer binding protein δ (C/EBPδ) expression and elevation in Alzheimer’s disease

  2004cited by this paper
• Flavonoid Baicalein Attenuates Activation-Induced Cell Death of Brain Microglia

  2003influential reference
• Flavonoids as aryl hydrocarbon receptor agonists/antagonists: effects of structure and cell context.

  2003cited by this paper
• Flavonoid wogonin from medicinal herb is neuroprotective by inhibiting inflammatory activation of microglia

  2003cited by this paper
• High‐yield isolation of murine microglia by mild trypsinization

  2003cited by this paper
• Silymarin protects dopaminergic neurons against lipopolysaccharide‐induced neurotoxicity by inhibiting microglia activation

  2002cited by this paper
• Gemfibrozil, a Lipid-lowering Drug, Inhibits the Induction of Nitric-oxide Synthase in Human Astrocytes*

  2002cited by this paper
• Microglia enhance beta-amyloid peptide-induced toxicity in cortical and mesencephalic neurons by producing reactive oxygen species.

  2002cited by this paper
• Gene expression profiling of 12633 genes in Alzheimer hippocampal CA1: Transcription and neurotrophic factor down‐regulation and up‐regulation of apoptotic and pro‐inflammatory signaling

  2002cited by this paper
• Microglia enhance β‐amyloid peptide‐induced toxicity in cortical and mesencephalic neurons by producing reactive oxygen species

  2002cited by this paper
• CCAAT/enhancer-binding proteins: structure, function and regulation.

  2002cited by this paper
• The Induction of Cyclooxygenase-2 mRNA in Macrophages Is Biphasic and Requires both CCAAT Enhancer-binding protein β (C/EBPβ) and C/EBPδ Transcription Factors*

  2001cited by this paper
• Suppression of inducible cyclooxygenase and nitric oxide synthase through activation of peroxisome proliferator‐activated receptor‐γ by flavonoids in mouse macrophages

  2001cited by this paper
• The induction of cyclooxygenase-2 mRNA in macrophages is biphasic and requires both CCAAT enhancer-binding protein beta (C/EBP beta ) and C/EBP delta transcription factors.

  2001cited by this paper
• Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

  2001cited by this paper
• Inflammatory Neurodegeneration Mediated by Nitric Oxide from Activated Glia-Inhibiting Neuronal Respiration, Causing Glutamate Release and Excitotoxicity

  2001cited by this paper
• Pro‐inflammatory cytokines induce the transcription factors C/EBPβ and C/EBPδ in astrocytes

  2000cited by this paper
• Transcriptional Activation of the Cyclooxygenase-2 Gene in Endotoxin-treated RAW 264.7 Macrophages*

  2000cited by this paper
• Quantification of neuron survival in monolayer cultures using an enzyme-linked immunosorbent assay approach, rather than by cell counting.

  1999cited by this paper
• CCAAT/enhancer-binding protein delta gene expression is mediated by autoregulation through downstream binding sites.

  1998cited by this paper
• The Role of C/EBP Isoforms in the Control of Inflammatory and Native Immunity Functions*

  1998cited by this paper
• NF-kappa B: a crucial transcription factor for glial and neuronal cell function.

  1997cited by this paper
• NF-kB: a crucial transcription factor for glial and neuronal cell function

  1997cited by this paper
• Immortalization of murine microglial cells by a v-raf/v-myc carrying retrovirus.

  1990influential reference
• Development of excitatory amino acid induced cytotoxicity in cultured neurons

  1990cited by this paper

• DOĞAL KAYNAKLARIN DİYABETİK NÖROPATİ TEDAVİSİNDEKİ ROLÜ

  2026cites this paper
• METTL14/m6A/CEBPD Axis: A Critical Player in Chronic Cerebral Hypoperfusion-Associated Neuroinflammation.

  2026cites this paper
• Chrysin's Anti-Inflammatory Action in the Central Nervous System: A Scoping Review and an Evidence-gap mapping of its Mechanisms.

  2025cites this paper
• Chrysin: A Comprehensive Review of Its Pharmacological Properties and Therapeutic Potential

  2025cites this paper
• Chrysin attenuates intervertebral disk degeneration via dual inhibition of matrix metalloproteinases and senescence: integrated network pharmacology, molecular docking, and experimental validation

  2025cites this paper
• Design, synthesis, bioactivity, X-ray crystallography, and molecular docking studies of chrysin-1,3,5-triazine derivatives as anticancer agents.

  2025cites this paper
• Network pharmacology unveils the intricate molecular landscape of Chrysin in breast cancer therapeutics

  2025cites this paper
• Galectin-9 activates microglial asparagine endopeptidase and promotes α-synuclein pathology in Parkinson's disease.

  2025cites this paper
• Unlocking the potential of natural products: A comprehensive review of chrysin derivatives and their biological activities

  2025cites this paper
• The Pros and Cons of Estrogens in Prostate Cancer: An Update with a Focus on Phytoestrogens

  2024cites this paper
• Development, optimization, and characterization of polymeric micelles to improve dasatinib oral bioavailability: Hep G2 cell cytotoxicity and in vivo pharmacokinetics for targeted liver cancer therapy

  2024cites this paper
• Unveiling the neuroprotective potential of chrysin on the pre-frontal cortex of adult male Wistar rats

  2024cites this paper
• Pyrotinib and chrysin synergistically potentiate autophagy in HER2-positive breast cancer

  2023cites this paper
• Strategic and Innovative Roles of lncRNAs Regulated by Naturally-Derived Small Molecules in Cancer Therapy.

  2023cites this paper
• Preparation, optimization, and characterization of chrysin-loaded TPGS-b-PCL micelles and assessment of their cytotoxic potential in human liver cancer (Hep G2) cell lines.

  2023cites this paper
• Clonostachys rosea, a marine algal endophyte, as an alternative source of chrysin and its anticancer effect

  2023cites this paper
• Design, synthesis, antitumor activity and ct-DNA binding study of photosensitive drugs based on porphyrin framework.

  2023cites this paper
• CCAAT/Enhancer-Binding Proteins in Fibrosis: Complex Roles Beyond Conventional Understanding

  2022cites this paper
• Anti-cancer Activity of Chrysin in Cancer Therapy: a Systematic Review

  2022cites this paper
• Neurological disorders of COVID-19: insights to applications of natural products from plants and microorganisms

  2022cites this paper
• CHRYSIN: PHARMACOLOGICAL AND BIOACTIVE EFFECTS

  2021cites this paper
• Computational Drug Repurposing for Alzheimer’s Disease Using Risk Genes From GWAS and Single-Cell RNA Sequencing Studies

  2021cites this paper
• MECP2 Increases the Pro-Inflammatory Response of Microglial Cells and Phosphorylation at Serine 423 Regulates Neuronal Gene Expression upon Neuroinflammation

  2021cites this paper
• Synthesis of new chrysin derivatives with substantial antibiofilm activity

  2021cites this paper
• Advancements in delivery of herbal drugs for cognitive disorders

  2021cites this paper
• Anticancer Activity of Half-Sandwich Ru, Rh and Ir Complexes with Chrysin Derived Ligands: Strong Effect of the Side Chain in the Ligand and Influence of the Metal

  2021cites this paper
• Parkinsonian neurotoxicants impair the anti-inflammatory response induced by IL4 in glial cells: involvement of the CD200-CD200R1 ligand-receptor pair

  2020cites this paper
• Synthesized chrysin-loaded nanoliposomes improves cadmium-induced toxicity in mice

  2020cites this paper
• Anticancer and Neuroprotective Activity of Chrysin: Recent Advancement

  2019cites this paper
• CCAAT/enhancer binding protein δ is a transcriptional repressor of α-synuclein

  2019cites this paper
• Chrysin inhibits sphere formation in SMMC-7721 cells via modulation of SHP-1/STAT3 signaling pathway

  2019cites this paper
• CMAR_A_193647 2977..2985

  2019cites this paper
• Dietary polyphenols and their roles in fat browning.

  2019cites this paper
• Parkinsonian Neurotoxins Impair the Pro-inflammatory Response of Glial Cells

  2019cites this paper
• Endophytic Fungi As the Alternate Source of High-Value Plant Secondary Metabolites

  2019cites this paper
• Role of C/EBP-β in Methamphetamine-Mediated Microglial Apoptosis

  2019cites this paper
• Chrysin ameliorates cerebral ischemia/reperfusion (I/R) injury in rats by regulating the PI3K/Akt/mTOR pathway.

  2019cites this paper
• Chrysin induces cell growth arrest, apoptosis, and ER stress and inhibits the activation of STAT3 through the generation of ROS in bladder cancer cells

  2018cites this paper
• [Chrysin inhibits lipopolysaccharide-induced inflammatory responses of macrophages via JAK-STATs signaling pathway].

  2018cites this paper
• Improved In vivo Effect of Chrysin as an Absorption Enhancer Via the Preparation of Ternary Solid Dispersion with Brij®L4 and Aminoclay

  2018cites this paper
• [Chrysin promotes SMMC-7721 cell apoptosis by regulating MAPKs signaling pathway].

  2018cites this paper
• A Naturally Occurring Flavone (Chrysin): Chemistry, Occurrence, Pharmacokinetic, Toxicity, Molecular Targets and Medicinal Properties

  2018cites this paper
• Chrysin cocrystals: Characterization and evaluation

  2017cites this paper
• Antinociceptive pharmacological profile of Dysphania graveolens in mouse.

  2017cites this paper
• Effect of Tualang (Apis dorsata) Honey on Development ofMorphine Tolerance in Rats

  2017cites this paper
• DHCR24 exerts neuroprotection upon inflammation-induced neuronal death

  2017influential citation
• Chrysin induces death of prostate cancer cells by inducing ROS and ER stress

  2017cites this paper
• Isolation and characterization of anticancer flavone chrysin (5,7-dihydroxy flavone)-producing endophytic fungi from Passiflora incarnata L. leaves

  2017cites this paper
• Development of a new certified reference material of high-purity chrysin for the quality control of traditional Chinese medicine

  2016cites this paper
• NEUROPROTECTIVE EFFECTS OF CHRYSIN ON ADULT MALE ALBINO RATS EXPOSED TO ACRYLAMIDE AND RADIATION

  2016cites this paper
• Human brain pericytes as mediators of neuroinflammation: Implications for disease and therapeutics

  2016cites this paper
• Chemical variability of common skullcap (Scutellaria galericulata L.) wild growing in the area of eastern Poland

  2016cites this paper
• Synthesis and Characterization of Chrysin-loaded PCL-PEG-PCL nanoparticle and its effect on breast cancer cell line.

  2016cites this paper
• Apigetrin from Scutellaria baicalensis Georgi Inhibits Neuroinflammation in BV-2 Microglia and Exerts Neuroprotective Effect in HT22 Hippocampal Cells

  2016cites this paper
• Synthesis of Glycosylated Chrysin Derivatives Via Ester Linkers

  2016cites this paper
• Chrysin induces brown fat-like phenotype and enhances lipid metabolism in 3T3-L1 adipocytes.

  2016cites this paper
• Bioactive Compounds and Their Neuroprotective Effects in Diabetic Complications

  2016cites this paper
• Luteolin and Apigenin Attenuate 4-Hydroxy-2-Nonenal-Mediated Cell Death through Modulation of UPR, Nrf2-ARE and MAPK Pathways in PC12 Cells

  2015cites this paper
• Chemopreventive and therapeutic potential of chrysin in cancer: mechanistic perspectives.

  2015cites this paper
• Cytotoxic, antitumour-promoting and inhibition of protein denaturation effects of flavonoids, isolated from Potentilla evestita Th. Wolf

  2015cites this paper
• Nebivolol and chrysin protect the liver against ischemia/reperfusion-induced injury in rats

  2015cites this paper
• C/EBPβ and C/EBPδ transcription factors: Basic biology and roles in the CNS.

  2015cites this paper
• Plant-Derived Polyphenols: A Chemopreventive and Chemoprotectant Worth-Exploring Resource in Toxicology

  2015cites this paper
• Neuroprotective effects of chrysin: From chemistry to medicine.

  2015cites this paper
• Chrysin attenuates experimental autoimmune neuritis by suppressing immuno-inflammatory responses.

  2014cites this paper
• Natural Product Research: Formerly Natural Product Letters

  2014cites this paper
• Dietary polyphenols for treatment of Alzheimer's disease--future research and development.

  2014cites this paper
• CD200R1 and CD200 expression are regulated by PPAR‐γ in activated glial cells

  2014influential citation
• Synthetic derivatives of chrysin and their biological activities

  2014cites this paper
• CCAAT-Enhancer Binding Protein-β Expression and Elevation in Alzheimer’s Disease and Microglial Cell Cultures

  2014cites this paper
• Chrysin inhibits metastatic potential of human triple‐negative breast cancer cells by modulating matrix metalloproteinase‐10, epithelial to mesenchymal transition, and PI3K/Akt signaling pathway

  2014cites this paper
• The Many Faces of C/EBPδ and their Relevance for Inflammation and Cancer

  2013cites this paper
• Chapter 3 – Phenolics

  2013cites this paper
• CCAAT/enhancer binding protein δ regulates glial proinflammatory gene expression.

  2013cites this paper
• Modelling Neuroinflammation In Vitro: A Tool to Test the Potential Neuroprotective Effect of Anti-Inflammatory Agents

  2012cites this paper
• Flavonoids and Neuroinflammation

  2012cites this paper
• Evaluation of the toxicity of the brominated flame retardants, PBDE-47 and HBCD, in neuronal cell lines

  2012cites this paper
• Neuroinflammation: modulation by flavonoids and mechanisms of action.

  2012cites this paper
• Inhibition of CD200R1 expression by C/EBP beta in reactive microglial cells

  2012cites this paper
• Role of Transcription Factors in Peripheral Nerve Regeneration

  2012cites this paper
• Pro-inflammatory gene expression and neurotoxic effects of activated microglia are attenuated by absence of CCAAT/enhancer binding protein β

  2011influential citation
• GCCTGTGAGACCTTTG GCATTGGAAGTGAAGCGTTTC GAATTGAAAGCCCTCT CCCCAAAGATAGCATCTGGA CGCGACGTGGAA ACCGCCTGGAGTTCTGGAA GTGTGACGTTCCCATTA CAGCACGAGGCTTTTTTGTTG TTTGGTAGCATCCATC CCGGAGAGGAGACTTCACAG CAAGAACAGCAACGAGTAC TGCGCAGGCGGTCATT TGAGCGACGAGTACAAGA GTCAGCTCCAGCACCTTGTG CGACTCCTGCCATGT GAAGAGGTCGGCGAAGAGT

  year unknowninfluential citation